Disruption of HNT2 and tetrad analysis of dinucleoside polyphosphate levels

An earlier report demonstrated that disruption of HNT2 was tolerated by haploid yeast strains without an effect on growth and that ApppN and AppppN accumulate 30 and 3-fold, respectively on account of the hnt2 deletion [13]. Because those data were obtained by random spore analysis, we considered it important to test whether elevated dinucleoside polyphosphate levels co-segregate with hnt2 disruption in all tetrads examined and whether any other commonly used genetic markers affect dinucleoside polyphosphate levels. Diploid strain BY71 (Table 1), created to be heterozygous for MAT, ADE2, HIS3, LEU2, LYS2, MET15, TRP1, URA3 and HNT2, was allowed to sporulate and was then dissected. As shown in Figure 1, tetrads produced four viable colonies, two of which were large and white, and two of which were smaller and pink on YPD medium, which scored as ade- on SDC -ade medium. Markers segregated 2:2 in nearly all cases and possession of a 1976 bp PCR fragment using primers 4726 and 4722 always correlated with geneticin-resistance while possession of a 1200 bp product correlated with geneticin-sensitivity, as expected for segregants containing a nondisrupted HNT2 gene.

Name	Genotype	Background and source
SEY6210	MATα his3Δ200 leu2-3,112 lys 2-81 suc2-Δ9 trp1-Δ901 ura3-52	S288C, [48]
BY4717	MA T a ade2Δ::hisG	S288C, [47]
BY4727	MATα his3Δ200 leu2Δ0 lys2Δ0 met15Δ0 trp1Δ63 ura3Δ0	S288C, [47]
BY16	MATα his3Δ200 leu2Δ0 lys2Δ0 met15Δ0 trp1Δ63 ura3Δ0 hnt2Δ::kanMX2	BY4727, this work
BY71	MAT a/MATα ADE2/ade2Δ::hisG HIS3/ his3Δ200 LEU2/leu2Δ0 LYS2/lys2Δ0 MET/met15Δ0 TRP1/trp1Δ63 URA3/ura3Δ0 HNT2/hnt2Δ::kanMX2	BY4717 × BY16, this work
BY71-1a	MATα his3Δ200 leu2Δ0 lys2Δ0 hnt2Δ::kanMX2	BY71 segregant, this work
BY71-1b	MATα ade2Δ::hisG his3Δ200 lys2Δ0 met15Δ0 trp1Δ63 ura3Δ0 hnt2Δ::kanMX2	BY71 segregant, this work
BY71-1c	MAT a ade2Δ::hisG leu2Δ0 met15Δ0 ura3Δ0	BY71 segregant, this work
BY71-1d	MA T a trp1Δ63	BY71 segregant, this work
BY71-2a	MATα ade2Δ::hisG leu2Δ0 met15Δ0 hnt2Δ::kanMX2	BY71 segregant, this work
BY71-2b	MATα his3Δ200 leu2Δ0 lys2Δ0 met15D0 ura3Δ0 hnt2Δ::kanMX2	BY71 segregant, this work
BY71-2c	MA T a ade2Δ::hisG his3Δ200 lys2Δ0 trp1Δ63 ura3Δ0	BY71 segregant, this work
BY71-2d	MA T a trp1Δ63	BY71 segregant, this work
BY71-4a	MAT a lys2Δ0 ura3Δ0 hnt2Δ::kanMX2	BY71 segregant, this work
BY71-4b	MATα his3Δ200 met15Δ0 ura3Δ0	BY71 segregant, this work
BY71-4c	MA T a ade2Δ::hisG his3Δ200 leu2Δ0 met15Δ0 trp1Δ63	BY71 segregant, this work
BY71-4d	MATα ade2Δ::hisG leu2Δ0 lys2Δ0 trp1Δ63 hnt2Δ::kanMX2	BY71 segregant, this work
BY71-6c	MAT a his3Δ200 leu2Δ0 met15Δ0 hnt2Δ::kanMX2	BY71 segregant, this work
BY71-16d	MAT a his3Δ200 leu2Δ0 met15Δ0	BY71 segregant, this work

Earlier, hnt2 deletion was reported to increase AppppN levels only 2.5-fold but the study was performed in ade2 mutants [13]. Consistent with that report, the three hnt2 ade2 strains showed only a 2-fold higher AppppN level than the three HNT2 ade2 strains, when nucleotide levels were averaged across the three time points. In contrast, hnt2ΔADE2 strains achieved a 3.7-fold higher level of AppppN than HNT2 ADE2 strains. Larger increases in AppppN concentrations have been seen with disruption of Apa1 and Apa2, the diadenosine tetraphosphate phosphorylases in S. cerevisiae[34, 35], indicating that they have a more significant role in controlling AppppN levels than does Hnt2. In the case of disruption of the Fhit and Hnt2-homologous aph1 gene in S. pombe, which encodes an enzyme relatively specific for a AppppA [20], a 290-fold increase in AppppA concentration was observed [22]. Our data indicate that Hnt2 hydrolyzes ApppN and AppppN in vivo in budding yeast and that an intact adenine biosynthetic pathway is required for high-level synthesis and accumulation of adenylylated dinucleoside polyphosphates.

Hnt2 active site-dependence of dinucleoside polyphosphate accumulation

Dinucleoside polyphosphate levels may not be limited by the levels of lysyl tRNA synthetase

AppppA is induced by heat shock in bacteria [36] and the induction of AppppA was thought to be a function of the heat-shock inducible LysU lysyl tRNA synthetase. However, deletion of lysU had no effect on heat-shock inducible AppppA accumulation [37]. The KRS1 gene [38] encoding cytosolic lysyl tRNA synthetase was cloned into multicopy plasmid pRS423 [39] to generate plasmid pM1. Strains BY71-16d (ADE2 HNT2) and BY71-6c (ADE2 hnt2) were transformed with pM1 and the pRS423 control plasmid, and cultures were harvested at 24, 48 and 72 hours. Determination of ApppN and AppppN concentrations revealed that ApppN levels are substantially higher in hnt2 mutants than in isogenic wild-types at all time points and that plasmids conferring multiple copies of KRS1 did not increase ApppN or AppppN levels at any culture time point (Table 5). To address whether plasmid pM1 indeed increased lysyl tRNA synthetase activity, lysates from pRS423 and pM1-transformed BY71-6c were assayed for incorporation of ³H lysine into yeast tRNA. As shown in Figure 2, tRNA-dependent lysine incorporation was increased 2.1-fold by expression of KRS1 from a multicopy plasmid.

Nucleotide	ApppN			AppppN
Culture Time	24 hr	48 hr	72 hr	24 hr	48 hr	72 hr
Relevant Genotype
HNT2	0.52	1.60	0.22	0.29	0.19	0.02
HNT2 YEpKRS1	1.28	1.29	0.20	0.34	0.22	0.01
hnt2Δ	6.25	14.10	3.54	0.35	0.26	0.02
hnt2Δ YEpKRS1	5.83	15.50	4.20	0.40	0.30	0.01

Heat shock is the most effective stress for elevation of dinucleoside polyphosphates

In the wild and in the laboratory, yeast are exposed to stresses such as hypo-osmotic or hyperosmotic conditions, toxic cations, heat shock and cell-cycle disruptive reagents. To test whether such conditions induce dinucleoside polyphosphates in hnt2- or Hnt2+ cells, we incubated ADE2 hnt2 and ADE2 HNT2 cells in water, 1 M sorbitol, 2 mM CdCl₂, 46 °C heat shock, 10 mM caffeine, or in rich media for two hours and determined dinucleoside polyphosphate levels. Additionally, to test whether moderate overexpression of the lysyl tRNA synthetase gene affected accumulation, we compared control transformants to multicopy KRS1 transformants of the two strains. As shown in Table 6, the hnt2 samples had substantially higher ApppN levels than HNT2 samples under all conditions. Among the hnt2 samples, only heat shocked samples showed evidence of ApppN levels higher than the levels in nonstressed hnt2 cells. Similarly, among the HNT2 samples, the heat shocked samples showed increased ApppN levels compared with control-treated cells while CdCl₂ and other treated samples showed no significant changes. KRS1 on a multicopy plasmid showed no significant alteration of ApppN levels in any sample. As with other experiments, AppppN levels were lower than ApppN levels in all cases. Heat shock was the best inducer of AppppN. Hypotonic, hypertonic and caffeine treated media produced no increase in AppppN (not shown).

To further investigate the kinetics of heat shock and cadmium-induction of ApppN and AppppN levels, we transformed hnt2ΔADE2 strain BY71-6c with multicopy plasmids containing no HNT2 gene, the wild-type HNT2 gene, or the HNT2-His109Ala or HNT2-His109Asp alleles of HNT2. Cultures were exposed to either 2 mM CdCl₂ or 46°C heat shock and intracellular concentrations of ApppN and AppppN were determined at 30-minute timepoints.

As shown in Figure 3, ApppN and AppppN levels are higher in hnt2 strains than in cells with a functional HNT2 gene, and were not significantly elevated by 2 mM CdCl₂. However, when cells were heat shocked, as shown in Figure 4, ApppN and AppppN levels increased substantially in cultures with every HNT2 genotype (absence, presence or active site mutation). Increases in dinucleoside polyphosphates in Hnt2+ cultures cannot be attributed to thermal inactivation of Hnt2 because the presence of HNT2 plasmids continues to reduce incremental increases in dinucleoside polyphosphates even in the fourth hour of the heat shock. Furthermore, the active-site mutant alleles of HNT2, HNT2-His109Ala and HNT2-His109Asp, provided on plasmids pB32 and pB86, demonstrated intermediate abilities to control dinucleoside polyphosphate levels, suggesting that elevated temperature reduces the catalytic defects of these mutant enzymes. The high levels of ApppN (~100 μM) and AppppN (~10 μM) and the fact that Hnt2-containing samples continue to reduce the rate of increase in dinucleoside polyphosphates without reducing their concentrations demonstrate that heat shock induces dinucleoside polyphosphate synthesis and that Hnt2 is saturated under such conditions. In Xenopus oocytes, however, some work has suggested that heat shock-dependent accumulation of AppppN is largely due to inactivation of degradative enzymes [30].

General molecular biology

Yeast media and procedures were as described [43, 44]. S. cerevisiae transformations were carried out by the lithium acetate method [45]. E. coli strain XL-1 Blue was used for bacterial cloning and plasmid amplification. Bacterial media and molecular biology techniques were as described [44].

Disruption of hnt2

Plasmid constructions

The HNT2 gene was amplified from genomic DNA of yeast strain SEY6210 [48] with primers PB1 (5'GCAGCGGATCCTTGGGAT) that spanned a Bam HI site upstream of the promoter and PB2 (5'GAGTCTCCTCGAGGAAAG) that spanned a Xho I site downstream of the terminator. The 1316 bp Bam HI-Xho I fragment containing HNT2 was ligated to Bam HI and Xho I-cleaved plasmid pRS423 [39] to generate plasmid pB05. Plasmids pB32 and pB86, carrying H109A and H109D alleles of HNT2, were constructed by site-directed mutagenesis [49] of plasmid pB05 using primers PB3 (5'ATAATGTGTGTAGCCAAGTGGGGT) and PB4 (5'TAATGTGTGTATCCAAGTGGGGTAC). The S. cerevisiae gene encoding lysyl tRNA synthetase (KRS1) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC). This product, cloned into the Sma I restriction site of plasmid pRS423, generated plasmid pM1 in which KRS1 is oriented anti to HIS3. Plasmids are summarized in Table 3.

Measurement of dinucleoside polyphosphate levels

Twelve haploid segregants, pregrown in liquid SDC medium, were inoculated into 250 ml of SDC at starting density of 10⁴ cells per ml. At 24, 48 and 72 hours of growth, 50 ml of cells were harvested, cells counted microscopically, lysed, and levels of AppppN and ApppN were determined as described [13]. Intracellular concentrations of ApppN and AppppN were calculated using 7 × 10^-14 l as the volume of a haploid cell [50]. Cultures of BY71-6c were transformed with plasmids pRS423, pB05, pB32 and pB86 and transformants were selected on SDC-his media. Intracellular concentrations of ApppN and AppppN were determined for transformants from cultures in SDC-his media as above. To determine whether a multicopy lysyl tRNA synthetase plasmid affected accumulation of dinucleoside polyphosphates, we transformed HNT2 ADE2 strain BY71-16d and hnt2ΔADE2 strain BY71-6c with control plasmid pRS423 and with plasmid pM1. Transformants were grown for 24, 48 and 72 hours in SDC-his media and intracellular dinucleoside polyphosphate concentrations were determined as above. To survey dinucleoside polyphosphate induction as a function of potential stress conditions, strain BY71-6c was transformed with either pRS423 or pM1 (effectively hnt2Δ and hnt2Δ YEpKRS1, respectively) and strain BY71-16d was transformed with the same plasmids (effectively HNT2Δ and HNT2Δ YEpKRS1, respectively). After 48 hours of culture, cells were pelleted and resuspended in either YPD media, water, SDC-his media, or the same media supplemented with 2 mM CdCl₂, 10 mM caffeine or 1 M sorbitol. The SDC-his sample was incubated for 2 hours at 46°C while other samples were incubated for 2 hours at room temperature prior to extraction for determination of dinucleoside polyphosphate concentrations. To determine the time course of ApppN and AppppN levels as a function of stresses, we used strains BY71-16d and BY71-6c transformed with pRS423, pB05, pB32, or pB86. Transformants were cultured for 48 hours, treated with 2 mM CdCl₂ or 46°C heat shock, and then harvested for nucleotide quantitation at 30 minute intervals. Experiments presented in Tables 2, 4, 5 and 6 were performed two, three, five and three times, respectively. Experiments presented in Figures 3 and 4 were performed four times each. Because diadenosine polyphosphate levels vary with time in culture, generating a higher or lower range of values in independently conducted experiments, we did not average values obtained in separate experiments. For the data presented in Table 6, triplicate cultures were prepared and the ApppN levels for identically treated samples are provided as averages ± standard deviations.

Lysyl tRNA synthetase activity assay

Strain BY71-6c was transformed with plasmids pRS423 and pM1 (multicopy KRS1) and cultures were grown as for measurement of dinucleoside polyphosphate levels. Lysates were prepared by glass bead disruption in 50 mM Tris Cl pH 7.5, 1 mM DTT, 40% glycerol. Incorporation of tritiated lysine into tRNA was measured by modification of the protocol of Hou [51]. Reactions contained 10 micrograms of total protein in 20 mM KCl, 10 mM MgCl₂, 4 mM dithiothreitol, 2 mM ATP, 50 mM Na HEPES pH 7.5, 20 μM lysine (10 μCi ³H lysine), and were performed with or without 15 μg yeast tRNA (Sigma) in a total volume of 60 μl. At one, two, three, five and twelve minute time points, 10 μl aliquots were spotted on filter paper and placed in 5% wt/vol trichloroacetic acid, washed in 5% trichloroacetic acid twice, washed twice in 95% ethanol, rinsed in ether and scintillation-counted.

Authors' note

Tetrads shown in figure 1 were dissected and PCR analyzed to show the procedure followed to obtain strains. They do not correspond to tetrads mentioned in table 1.