Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Molecular Biology

Open Access

Messenger RNA profile analysis deciphers new Esrrb responsive genes in prostate cancer cells

BMC Molecular Biology201516:21

https://doi.org/10.1186/s12867-015-0049-1

Received: 28 June 2015

Accepted: 13 November 2015

Published: 1 December 2015

Abstract

Background

Orphan nuclear receptor estrogen related receptor β (Esrrb or ERRβ) is well known in stem cells and early embryonic development. However, little is known about its function in cancer.

Method

We investigated the mRNA profile alterations induced by Esrrb expression and its synthetic ligand DY131 in human prostate cancer DU145 cells via RNA-Seq analysis.

Results

We distinguished 67 mRNAs differentially expressed by Esrrb alone. Although DY131 alone did not change any gene, treatment of DY131 in the presence of Esrrb altered 1161 mRNAs. These observations indicated Esrrb had both ligand-independent and ligand-dependent activity. When Esrrb was expressed, DY131 treatment further regulated 15 Esrrb-altered mRNAs. DY131 acted as an antagonist for 11 of 15 mRNAs (wdr52, f13a1, pxdn, spns2, loc100506599, tagln, loc441454, tkel1, sema3f, zcwpw2, sdc2) and as an agonist for 4 of the 15 mRNAs (rarres3, oasl, padi2, ddx60). Gene ontology analyses showed altered genes are related to transcription and translation regulation, cell proliferation and apoptosis regulation, and cellular metabolism.

Conclusion

Our results characterized mRNA profiles in DU145 prostate cancer cells driven by Esrrb expression and Esrrb ligand DY131, and provided multiple markers to characterize Esrrb’s function in Esrrb research.

Keywords

Estrogen related receptorRNA-SeqProstate cancerGene expression profileDY131Transcription regulationNuclear receptor

Background

Esrrb encodes nuclear receptor estrogen related receptor β (Esrrb), which belongs to the nuclear receptor family. Esrrb acts as a transcription factor by binding to a specific DNA sequence estrogen related receptor response element (ERRE), which is also known as steroid factor response element (SFRE), or half site estrogen response element [1, 2].

Esrrb, first cloned in 1988, was not intensively studied until recent years. Knocking out of Esrrb was embryonic lethal due to placental malformation [3]. Though early studies showed a very limited range of tissues with positive Esrrb expression, recent studies reported that short form Esrrb alternative splicing isoform had a broad range of expression [4]. Esrrb was found to be a core-reprogramming factor to reprogram Pluripotent Stem Cells (iPSCs) [36]. c-myc and klf4 of the OSKM (oct4, sox2, klf4, c-myc) core-reprogramming factors can be replaced by Esrrb [5, 6]. Esrrb was also recently reported to drive sox2 transcription and induce iPSC in a single cell system [7].

Tumorigenesis and tumor progression are related to Esrrb. Esrrb was shown to be down-regulated in prostate cancer epithelium compared to normal prostate tissue [810]. Its re-expression in DU145 and LNCaP cells was shown to stimulate tumor suppressor cdkn1a (p21) concentration. Also, Esrrb can inhibit Estrogen Receptor transcriptional activity in uterine endometrial cancer cells and Nrf2-Keap signaling pathway in breast cancer cells [11, 12].

There are a handful of transcriptome-wide expression survey data from Esrrb knockdown in both human iPSCs and mouse embryonic stem cells [1316]. Known Esrrb controlled genes include klf4, c-myc, cdkn1a and cyp19a1, but Esrrb target genes in cancer cells are still not known.

This manuscript focuses on the discovery of Esrrb ligand-independent and Esrrb ligand-dependent target genes. We performed RNA-Seq analysis to characterize Esrrb regulated mRNAs in a prostate cancer cell line and we found the treatment of DY131 expanded Esrrb’s transcriptional regulation activity to many more genes.

Results

Establishment of the Esrrb stably transfected DU145 cells

Esrrb expression vector or control pcDNA3.1 (Zeo+) vector were transfected into DU145 cells. After 3 weeks of Zeocine selection, we characterized the Esrrb status by reverse transcriptase (RT)-PCR, qPCR and western blot analysis (Fig. 1a–c). Our results showed that Esrrb was successfully expressed in DU145-Esrrb cells. Although RNA-Seq showed that DU145-pc3.1 cells had a very small amount of Esrrb expressed (count per million read <1), the Esrrb concentration is below the detection limit of RT-PCR and western blot. Compared to HEK293 cells, which expressed endogenous Esrrb, overexpression of Esrrb in DU145 cells raised the Esrrb protein concentration to a comparable physiological concentration (Fig. 1b). In addition, our RT-PCR results and RNA-seq results confirmed the estrogen related receptor gamma (Esrrg) was not expressed in DU145 cells. The absence of Esrrg eliminated any possible functional contamination by Esrrg in our Esrrb studies (Fig. 1c).
Fig. 1

Characterization of Esrrb-expressing cancer cell line. Esrrb status of two independent replicates of stable transfected control DU145-pc3.1 and DU145-Esrrb cells are tested by a quantitative PCR b Western blot and c reverse transcriptase PCR. a Relative mRNA concentrations of Esrrb were measured by qPCR, Esrrb transcripts concentration were determined by standard curve method and Esrrb concentration were first normalized to the concentration of house keeping gene GAPDH, then normalized to Esrrb/GAPDH ratio of DU145-pc3.1 cells. b Total protein was extracted form HEK293, DU145-Esrrb and control DU145-pc3.1 cells. Protein concentration of Esrrb was determined by western blot using GAPDH as internal control. c RT-PCR was performed on total RNA extracted from HEK293, DU145-esrrb and control DU145-pc3.1 cells. Esrrb was expressed in DU145-Esrrb cells, while Esrrg is not expressed in either DU145-pc3.1 and DU145-Esrrb cells

Esrrb expression alters mRNA profile

To distinguish genes regulated by Esrrb, we performed RNA-Seq analysis on cDNA libraries constructed from two biological replicates of both DU145-pc3.1 and DU145-Esrrb cells. Spearman ranking correlation analysis showed that the expression of Esrrb in DU145 created a distinct transcriptome compared to control DU145-pc3.1 cells (Fig. 2a). We found 67 genes (21 genes up-regulated, 46 genes down-regulated) altered due to Esrrb expression (Fig. 2b; Table 1). Seven genes that are among the most changed genes (zcwpw2, hoxb8, tagln, f13a1, pxdn, aox1, and bmp4, as well as tgfβ as a negative control) were confirmed by qPCR (Fig. 3). Gene ontology (GO) analysis shows that the products of Esrrb driven differentially expressed genes fell into functional categories of regulation of cell development as well as immune responses (Table 2).
Fig. 2

Transcriptome correlation and Esrrb altered mRNAs. a Transcriptome correlation analysis was performed using Spearman Ranking Correlation. Color represents the correlation coefficient. DY131 treatment to DU145-Esrrb cells results in the lowest correlation coefficient with DU145-pc3.1 cells. b Dot plot of Esrrb-induced gene expression alteration. Genes expressed at adequate level are tested for differential gene expression test. The plot was made by plotting the Log2FC (fold change) against the Log2 cpm (count-per-million) difference. Red color marks the genes that are significant differentially expressed (FDR < 0.05), and the blue lines marked the Log2FC cutoff value (Log2FC > 1 or Log2FC < −1). 67 genes passed both thresholds

Table 1

Esrrb altered mRNAs

Gene symbol

logFC

P value

FDR

AOX1

−3.49

4.89E−184

3.19E−180

PXDN

−2.79

4.45E−87

1.16E−83

F13A1

−2.68

9.28E−114

4.04E−110

BMP4

−2.59

1.69E−29

1.16E−26

NPTX1

−2.11

1.06E−46

1.73E−43

SPNS2

−1.70

8.70E−31

7.09E−28

DDX60

−1.61

2.43E−15

4.46E−13

NEFL

−1.61

1.84E−13

2.85E−11

OASL

−1.60

1.30E−25

7.07E−23

IFIT3

−1.60

4.29E−42

5.09E−39

WDR52

−1.50

1.85E−06

7.40E−05

C3

−1.43

7.81E−09

5.73E−07

LOC344887

−1.41

5.01E−20

1.49E−17

PCDHB15

−1.41

6.25E−06

0.00020978

CXorf57

−1.41

1.78E−10

1.92E−08

IFI6

−1.38

1.09E−19

2.91E−17

CXCR4

−1.32

3.23E−06

0.00011537

GBP1

−1.31

1.43E−07

7.57E−06

IGFBP3

−1.31

3.19E−89

1.04E−85

ZSCAN12P1

−1.30

0.00015585

0.00302695

RNF128

−1.29

1.58E−10

1.73E−08

SAMD9

−1.29

2.69E−22

1.13E−19

UNC5A

−1.28

8.28E−07

3.62E−05

MX2

−1.27

1.68E−06

6.86E−05

SSBP2

−1.26

5.96E−05

0.00141054

MX1

−1.25

5.99E−22

2.37E−19

SULT4A1

−1.20

4.94E−05

0.00120711

DPYD

−1.19

1.35E−05

0.00040257

NEBL

−1.18

1.16E−12

1.62E−10

TAGLN

−1.18

5.48E−30

3.97E−27

INA

−1.17

2.47E−05

0.0006739

BMF

−1.16

3.32E−05

0.00085559

ESRP1

−1.13

0.00014206

0.00283503

GJA3

−1.12

1.38E−05

0.00040614

IFIT2

−1.11

1.02E−19

2.76E−17

LOC1005065

−1.10

8.53E−05

0.0018618

RARRES3

−1.07

1.84E−07

9.68E−06

TMEM45A

−1.06

4.69E−06

0.00016245

LGALS3BP

−1.05

4.57E−17

9.63E−15

ERAP2

−1.05

1.83E−50

3.41E−47

WNT10A

−1.05

0.00024417

0.00440189

PADI2

−1.04

1.13E−17

2.55E−15

REEP1

−1.01

0.00024704

0.0044413

AMIGO2

−1.01

8.26E−45

1.08E−41

HES1

−0.98

1.30E−07

7.01E−06

FRMD4B

−0.98

0.00014442

0.00284746

NRIP3

0.97

4.28E−14

6.90E−12

HOXB8

0.98

3.60E−11

4.33E−09

KCNQ5

0.98

5.87E−08

3.55E−06

COX6B2

0.99

1.24E−07

6.77E−06

PPFIBP2

1.04

6.38E−07

2.92E−05

KIAA1199

1.06

1.21E−25

6.89E−23

BST1

1.08

4.97E−13

7.30E−11

LOC1001336

1.13

0.00019921

0.00370382

SMOC1

1.15

1.52E−06

6.32E−05

LOC441454

1.15

9.40E−06

0.00029713

DDIT4L

1.18

2.28E−10

2.39E−08

SEMA3F

1.27

2.08E−20

6.96E−18

DUOX1

1.35

5.37E−09

4.25E−07

ARHGAP24

1.39

6.40E−10

6.01E−08

CDHR1

1.44

2.04E−06

7.93E−05

SDC2

1.44

1.49E−08

1.04E−06

SH3RF3

1.44

1.32E−05

0.00039562

PRSS8

1.45

6.96E−06

0.00022989

TKTL1

1.90

3.68E−21

1.33E−18

FGB

1.96

5.57E−22

2.27E−19

ZCWPW2

5.22

3.47E−215

4.53E−211

Fig. 3

Esrrb-regulated mRNA validation. Left panel qPCR validation of Esrrb-regulated mRNAs. Expression values were firstly normalized to Gapdh and normalized ratios are further normalized to that of DU145-pc3.1. Error bars represent standard deviation. Student t test was performed for statistical analysis (*p < 0.05). Seven genes were differentially expressed in both RNA-seq and qPCR, 1 gene, TGFbeta, is not differentially expressed in either assay and serves as a negative control. Right panel RNA-Seq analysis result, fold change (FC) indicates the ratio of normalized read counts in DU145-Esrrb to that of DU145-pc3.1

Table 2

Gene ontology analysis of Esrrb altered mRNAs

Term

Count

P value

GO:0060284 ~ regulation of cell development

5

0.006

GO:0006955 ~ immune response

8

0.012

GO:0009611 ~ response to wounding

7

0.012

GO:0042542 ~ response to hydrogen peroxide

3

0.017

GO:0050767 ~ regulation of neurogenesis

4

0.022

GO:0006800 ~ oxygen and reactive oxygen species metabolic process

3

0.024

GO:0060052 ~ neurofilament cytoskeleton organization

2

0.029

GO:0000302 ~ response to reactive oxygen species

3

0.03

GO:0051960 ~ regulation of nervous system development

4

0.032

GO:0031960 ~ response to corticosteroid stimulus

3

0.038

GO:0010035 ~ response to inorganic substance

4

0.038

GO:0045661 ~ regulation of myoblast differentiation

2

0.039

GO:0048667 ~ cell morphogenesis involved in neuron differentiation

4

0.04

DY131 requires Esrrb to affect gene expression

To get a more comprehensive understanding of Esrrb-regulated genes and characterize Esrrb’s potential ligand dependent activity, control DU145-pc3.1 and DU145-Esrrb cells were treated with Esrrb/Esrrg synthetic ligand DY131. Since both qPCR and RNA-seq show Esrrb transcript concentration is extremely low in DU145 cells and Esrrg is absent, and Esrrb protein concentration is also below the detection limit of western-blot analysis, it was not surprising to observe DY131 treatment without Esrrb expressed did not result in any gene differentially expressed (Fig. 4a). After we applied DY131 to DU145-Esrrb cells, we found DY131 treatment most significantly modified the transcriptome (Figs. 2a, 4b). Further comparison of DU145-Esrrb cells alone to DY131-treated DU145-Esrrb cells detected 1161 altered mRNAs (861 down-regulated, 300 up-regulated). 15 of them overlapped with Esrrb-induced mRNA alterations (Fig. 4c, d; Table 3). We defined an Esrrb agonist as a ligand that moves the mRNA concentration in the direction as Esrrb does; and an antagonist moves the concentration in the opposite direction as Esrrb does. By comparing the trend of the altered genes induced by Esrrb expression and DY131 treatment, DY131 acts as an agonist for 4 of the 15 genes, and an antagonist for 11 of the 15 genes (Fig. 4d). There are another 1146 mRNAs changed with both Esrrb and DY131 treatment compared to Esrrb alone, indicating their responses is ligand-dependent (Table 3).
Fig. 4

mRNA alteration by DY131 requires Esrrb expression. a DY131 treatment alone did not alter the expression of any gene. In contrast, when Esrrb was expressed, b DY131 altered 1161 mRNAs. c Venn Diagram of pairwise comparisons of altered mRNAs showed 15 (p = 0.0014) Esrrb altered mRNAs can be further regulated by DY131 treatment (overlap between Esrrb vs. control and Esrrb + DY131 vs. Esrrb). d Heat map of mRNA concentration of the 15 genes that response to both Esrrb expression as well as DY131 treatment. Log2-transformed normalized read counts of these 15 genes were color coded. DY131 is an agonist for 4 mRNAs that are responsive to Esrrb, while it is an antagonist of Esrrb in regulating the other 11 mRNAs

Table 3

DY131 altered mRNAs when Esrrb is expressed

Gene symbol

logFC

P value

FDR

MTRNR2L8

−6.83

0

0

MTRNR2L10

−5.31

9.85E−242

4.62E−239

SNHG5

−5.11

1.21E−277

6.66E−275

RPS29

−4.91

0

0

SEC61G

−4.48

2.94E−165

7.90E−163

RPL36A

−4.35

2.3501596881585

0.00E+00

RPL12

−3.62

0

0

TMEM212

−3.60

1.12E−56

4.20E−55

ESRG

−3.58

6.76E−114

9.61E−112

NEDD8-MDP1

−3.47

7.24E−102

7.97E−100

FOS

−3.34

2.98E−53

9.94E−52

SLIRP

−3.28

1.01E−127

1.85E−125

MTRNR2L1

−3.12

0

0

LGALS3

−2.94

3.19E−115

4.69E−113

SYTL1

−2.93

9.57E−29

1.23E−27

CLIC3

−2.80

7.42E−29

9.60E−28

WISP2

−2.80

7.36E−56

2.71E−54

ABCD3

−2.74

5.71E−21

4.79E−20

TNNT1

−2.69

4.26E−53

1.42E−51

RPL31

−2.68

0

0

ASS1

−2.66

2.78E−30

3.82E−29

EGR1

−2.63

0

0

PSMA1

−2.57

3.99E−89

3.55E−87

MRPL4

−2.56

5.21E−98

5.36E−96

ACPI

−2.55

8.68E−27

1.02E−25

USMG5

−2.54

4.08E−124

6.97E−122

CRIP1

−2.52

7.63E−155

1.76E−152

STAT4

−2.46

5.11E−22

4.64E−21

NDUFA11

−2.45

2.16E−93

2.05E−91

SCFD1

−2.44

6.21E−304

4.14E−301

CYBA

−2.44

5.78E−17

3.76E−16

NAPSA

−2.43

2.66E−17

1.77E−16

RPL13AP5

−2.43

0

0

RPL9

−2.42

0

0

TCTEX1D2

−2.41

6.26E−19

4.62E−18

MKNK2

−2.35

4.60E−83

3.57E−81

RPL18

−2.35

0

0

MUC1

−2.33

2.97E−73

1.75E−71

SEPP1

−2.33

4.57E−14

2.42E−13

PDE9A

−2.32

1.44E−65

7.05E−64

SEMA6B

−2.32

1.67E−53

5.59E−52

RPS15A

−2.30

0

0

CNTN1

−2.29

3.68E−18

2.58E−17

CA11

−2.28

8.82E−26

9.90E−25

TXN

−2.27

0

0

LOC728730

−2.26

4.28E−15

2.45E−14

GSTM1

−2.26

3.08E−39

6.17E−38

MACROD1

−2.26

5.25E−17

3.42E−16

CBLC

−2.25

5.56E−23

5.30E−22

SUCLG2

−2.24

7.28E−112

9.70E−110

PDCD4

−2.21

4.54E−103

5.13E−101

NDUFB2

−2.16

8.58E−73

4.91E−71

C4orf48

−2.16

1.10E−16

7.00E−16

PIR-FIGF

−2.15

1.69E−35

2.92E−34

DHRS3

−2.13

4.91E−20

3.92E−19

RPL38

−2.12

4.53E−247

2.20E−244

COX17

−2.11

5.14E−26

5.86E−25

NFE2

−2.10

7.00E−10

2.63E−09

RAB26

−2.09

1.66E−09

6.04E−09

NAPRT1

−2.09

1.48E−116

2.20E−114

CDK5

−2.08

1.31E−28

1.67E−27

NUCB2

−2.08

2.91E−88

2.49E−86

CEBPD

−2.07

5.29E−83

4.08E−81

DYNC2LI1

−2.07

5.50E−21

4.63E−20

RPL34

−2.06

6.26E−174

1.88E−171

SNRPF

−2.06

3.85E−103

4.39E−101

BCKDHB

−2.05

9.69E−26

1.09E−24

ANXA1

−2.04

0

0

RARS2

−2.04

4.40E−37

8.15E−36

CYP4F11

−2.04

1.11E−18

8.08E−18

SPC24

−2.03

1.42E−17

9.58E−17

PTP4A3

−2.02

4.47E−19

3.34E−18

LOC728190

−2.02

1.35E−12

6.39E−12

PSME1

−2.01

1.62E−81

1.20E−79

POLE2

−2.00

3.59E−57

1.37E−55

NSMCE4A

−2.00

1.78E−61

7.54E−60

FRA10AC1

−2.00

6.45E−43

1.50E−41

RPS12

−2.00

2.44E−295

1.47E−292

MTRNR2L2

−2.00

4.85E−167

1.33E−164

TYMP

−2.00

1.58E−35

2.74E−34

RPL11

−2.00

0

0

CCDC152

−1.99

6.61E−10

2.49E−09

MXD3

−1.96

3.65E−27

4.38E−26

IL17RC

−1.95

3.51E−23

3.39E−22

GRB7

−1.95

1.64E−32

2.49E−31

LOC441454

−1.94

8.75E−10

3.24E−09

PCCA

−1.94

1.00E−21

8.91E−21

ACBD4

−1.94

2.15E−40

4.51E−39

APLP1

−1.93

7.74E−24

7.77E−23

QARS

−1.93

2.90E−156

6.93E−154

STX8

−1.93

7.69E−26

8.67E−25

TM2D1

−1.92

8.60E−25

9.14E−24

C17orf61

−1.92

1.03E−53

3.49E−52

LOC100507156

−1.91

2.19E−24

2.27E−23

KCNAB2

−1.89

1.65E−43

3.93E−42

CERS4

−1.88

1.66E−27

2.01E−26

C18orf8

−1.86

1.06E−73

6.36E−72

NOTCH3

−1.86

1.46E−16

9.26E−16

LHPP

−1.86

1.93E−12

9.03E−12

GNG7

−1.85

2.37E−13

1.19E−12

RTN2

−1.85

2.10E−09

7.55E−09

SEMA3B

−1.84

2.45E−16

1.52E−15

IL6

−1.84

5.35E−17

3.49E−16

LOC644961

−1.84

1.43E−11

6.24E−11

JPX

−1.83

7.74E−11

3.17E−10

CHCHD6

−1.83

7.00E−19

5.14E−18

PNPLA6

−1.83

3.33E−86

2.77E−84

FBLN1

−1.82

5.31E−33

8.33E−32

SIDT2

−1.81

5.19E−40

1.07E−38

DEPTOR

−1.81

1.85E−10

7.26E−10

ZNF826P

−1.81

1.25E−08

4.21E−08

TTC39A

−1.81

4.87E−17

3.18E−16

TM7SF2

−1.81

1.91E−67

9.80E−66

ELMO3

−1.81

2.54E−22

2.33E−21

OOEP

−1.81

8.06E−10

3.00E−09

DNAJC17

−1.81

1.40E−14

7.72E−14

TCEA2

−1.80

1.83E−36

3.29E−35

SLC22A18

−1.80

1.89E−19

1.45E−18

ALDH3B1

−1.80

3.28E−68

1.70E−66

LOC100130872

−1.80

6.08E−10

2.30E−09

ETFA

−1.79

1.34E−136

2.74E−134

THYN1

−1.79

9.07E−41

1.92E−39

AKR1C3

−1.78

1.37E−10

5.47E−10

MT1F

−1.78

1.45E−08

4.86E−08

PIP5KL1

−1.78

2.53E−10

9.85E−10

ATP5D

−1.78

1.68E−44

4.13E−43

TMEM120A

−1.77

1.49E−25

1.64E−24

OSBPL5

−1.77

3.00E−09

1.06E−08

TENC1

−1.77

2.65E−18

1.89E−17

EPHX2

−1.76

3.95E−14

2.10E−13

WDR83

−1.76

4.37E−26

4.99E−25

RUVBL2

−1.75

8.63E−147

1.95E−144

KAZALD1

−1.75

6.39E−22

5.77E−21

RPA3

−1.74

6.68E−41

1.42E−39

NOXA1

−1.74

1.23E−09

4.49E−09

TMEM110-MUSTN1

−1.74

5.21E−08

1.65E−07

CACNA2D2

−1.74

8.47E−10

3.14E−09

DICER1-AS1

−1.73

5.04E−10

1.91E−09

ABHD14A-ACY1

−1.73

1.20E−36

2.19E−35

GRAMD2

−1.73

5.14E−08

1.63E−07

PPIH

−1.73

2.97E−19

2.25E−18

STXBP2

−1.73

2.73E−72

1.55E−70

C10orf10

−1.73

3.54E−21

3.02E−20

PLA2G6

−1.73

5.59E−14

2.93E−13

CHEK2

−1.72

1.79E−46

4.82E−45

SPAG4

−1.72

2.30E−15

1.34E−14

COG6

−1.71

9.36E−37

1.71E−35

TBC1D17

−1.71

7.78E−24

7.79E−23

IFT52

−1.71

6.78E−38

1.30E−36

GARNL3

−1.71

7.22E−11

2.96E−10

DLST

−1.70

2.44E−25

2.67E−24

ACSF2

−1.69

3.58E−13

1.77E−12

RYR1

−1.69

4.48E−09

1.57E−08

LOC100134713

−1.68

3.06E−12

1.41E−11

P2RY6

−1.68

7.55E−21

6.27E−20

RARRES3

−1.68

3.75E−07

1.09E−06

C11orf80

−1.67

5.34E−14

2.81E−13

ELF3

−1.67

2.30E−48

6.58E−47

ADCK4

−1.67

2.68E−40

5.60E−39

GLB1L

−1.67

5.33E−14

2.80E−13

LPPR3

−1.67

1.58E−24

1.66E−23

CDK7

−1.67

1.76E−36

3.16E−35

SLC6A3

−1.66

8.34E−08

2.58E−07

ADAM22

−1.66

2.07E−12

9.64E−12

EIF3K

−1.66

1.65E−98

1.73E−96

S100A4

−1.65

7.75E−10

2.89E−09

ANXA6

−1.65

2.84E−85

2.35E−83

IFT140

−1.65

1.33E−25

1.48E−24

PDIA5

−1.65

1.47E−23

1.44E−22

FADS3

−1.65

2.21E−48

6.32E−47

KCNK15

−1.64

4.58E−21

3.89E−20

FKBP10

−1.64

8.94E−41

1.89E−39

ACSS2

−1.64

1.07E−94

1.06E−92

GSTA4

−1.64

2.80E−31

4.04E−30

KCNMB4

−1.64

8.53E−07

2.38E−06

RPLP2

−1.63

3.48E−220

1.52E−217

UROS

−1.63

2.54E−42

5.73E−41

IFT27

−1.63

4.67E−19

3.49E−18

TRAPPC9

−1.63

6.82E−28

8.44E−27

ADAMTSL4

−1.62

5.48E−43

1.28E−41

EIF3E

−1.62

3.34E−248

1.69E−245

ACY1

−1.62

2.83E−30

3.87E−29

MT1X

−1.62

4.27E−24

4.36E−23

LOC643406

−1.61

4.55E−16

2.79E−15

FBXO36

−1.61

1.48E−14

8.12E−14

PACSIN1

−1.61

5.93E−08

1.87E−07

NIT2

−1.61

4.39E−45

1.10E−43

FUZ

−1.60

3.08E−12

1.42E−11

RPL37

−1.60

2.00E−301

1.27E−298

ALDH4A1

−1.60

2.17E−17

1.45E−16

PDCD5

−1.60

6.19E−65

2.92E−63

MFSD3

−1.60

3.51E−31

5.00E−30

EML3

−1.60

1.27E−64

5.92E−63

PSMA3

−1.60

1.93E−96

1.96E−94

TRPT1

−1.59

2.64E−23

2.56E−22

ALDH6A1

−1.59

9.68E−21

8.00E−20

LOC283038

−1.59

3.12E−11

1.32E−10

BDH2

−1.59

1.27E−17

8.59E−17

SDHB

−1.59

1.43E−70

7.78E−69

ARHGEF25

−1.59

1.35E−29

1.79E−28

CYS1

−1.58

4.38E−08

1.40E−07

C8orf45

−1.58

4.42E−08

1.41E−07

GLTSCR2

−1.57

4.94E−46

1.30E−44

JMJD8

−1.57

3.93E−28

4.90E−27

ANKRD24

−1.57

1.17E−07

3.56E−07

SNURF

−1.57

6.25E−68

3.23E−66

SNRPN

−1.57

6.43E−68

3.31E−66

RCN3

−1.57

1.28E−15

7.56E−15

LACTB2

−1.57

2.50E−78

1.75E−76

HSF4

−1.56

1.23E−13

6.27E−13

ENDOV

−1.56

4.24E−09

1.48E−08

CPT1C

−1.55

4.07E−07

1.17E−06

ITFG1

−1.55

1.10E−88

9.66E−87

IL11RA

−1.55

2.61E−11

1.12E−10

FRG1

−1.55

2.08E−08

6.87E−08

CCDC104

−1.54

8.93E−31

1.25E−29

CERS1

−1.54

4.07E−08

1.30E−07

GDF1

−1.54

4.07E−08

1.30E−07

USP4

−1.54

4.05E−13

2.00E−12

PLCD1

−1.54

6.66E−14

3.47E−13

PBXIP1

−1.54

5.25E−37

9.70E−36

NDUFC1

−1.54

1.61E−42

3.66E−41

CEP70

−1.54

5.71E−59

2.29E−57

MFSD4

−1.54

2.40E−07

7.10E−07

ARPC4-TTLL3

−1.53

3.34E−25

3.64E−24

XRCC1

−1.53

7.89E−35

1.33E−33

CLDN4

−1.52

2.47E−20

2.00E−19

VWA5A

−1.52

7.77E−10

2.90E−09

PC

−1.52

1.73E−20

1.41E−19

MMP11

−1.52

1.58E−09

5.74E−09

C9orf84

−1.52

1.04E−28

1.33E−27

SLC37A2

−1.52

1.08E−06

2.99E−06

SUPT3H

−1.52

5.13E−12

2.33E−11

SLC44A3

−1.52

1.17E−11

5.15E−11

UNC93B1

−1.52

6.48E−37

1.19E−35

SLC38A6

−1.52

1.32E−13

6.69E−13

NDUFA1

−1.51

4.88E−40

1.01E−38

TMEM205

−1.51

4.08E−37

7.58E−36

ZCRB1

−1.51

2.46E−88

2.13E−86

BRSK1

−1.50

7.65E−10

2.86E−09

HDAC5

−1.50

3.47E−33

5.53E−32

RNASEH2B

−1.50

1.90E−22

1.76E−21

CLASRP

−1.50

4.14E−23

3.98E−22

CAMK1

−1.50

1.12E−21

1.00E−20

C11orf10

−1.49

1.26E−42

2.91E−41

PRKCSH

−1.49

5.06E−129

9.41E−127

PMF1-BGLAP

−1.49

3.71E−34

6.12E−33

NFASC

−1.49

1.16E−05

2.86E−05

LTBP4

−1.49

2.21E−61

9.29E−60

LAMA5

−1.49

2.31E−160

6.08E−158

LRSAM1

−1.49

5.65E−26

6.42E−25

CTSH

−1.48

6.14E−31

8.67E−30

HEXB

−1.48

7.22E−108

8.96E−106

MGST2

−1.48

1.97E−09

7.13E−09

FAH

−1.48

8.07E−22

7.23E−21

PEX7

−1.48

2.91E−14

1.56E−13

C5

−1.48

1.05E−11

4.64E−11

ACADS

−1.48

2.02E−21

1.76E−20

IFT43

−1.47

9.38E−15

5.24E−14

JAK3

−1.47

6.46E−12

2.90E−11

MRPL39

−1.47

1.89E−45

4.88E−44

SLC43A1

−1.47

3.84E−08

1.23E−07

EFEMP2

−1.47

9.20E−07

2.56E−06

SSBP4

−1.47

1.48E−14

8.14E−14

IMMP1L

−1.47

1.82E−07

5.46E−07

GPR108

−1.47

1.33E−60

5.50E−59

WDR54

−1.46

4.01E−38

7.75E−37

ARHGAP8

−1.46

4.37E−14

2.32E−13

RPL35A

−1.46

8.72E−183

2.76E−180

GBP2

−1.46

7.43E−12

3.31E−11

TECR

−1.46

1.15E−73

6.86E−72

AUH

−1.46

1.97E−08

6.54E−08

PRR5-ARHGAP8

−1.46

1.99E−14

1.08E−13

LINC00263

−1.45

7.89E−17

5.07E−16

PDLIM2

−1.45

2.48E−44

6.06E−43

RASA2

−1.45

1.41E−19

1.09E−18

PTPN6

−1.45

1.25E−36

2.27E−35

PARL

−1.45

2.07E−65

1.00E−63

CERCAM

−1.45

1.71E−74

1.04E−72

RPL37A

−1.45

3.14E−201

1.14E−198

ARRDC3

−1.45

2.82E−84

2.26E−82

NAE1

−1.45

1.38E−78

9.72E−77

MYZAP

−1.45

7.55E−09

2.60E−08

FBXO2

−1.44

3.57E−23

3.45E−22

C1QL1

−1.44

1.45E−18

1.05E−17

FDPS

−1.44

1.12E−208

4.30E−206

FER1L4

−1.44

2.19E−34

3.63E−33

TMEM8B

−1.44

2.90E−24

3.00E−23

THOC6

−1.44

1.49E−31

2.17E−30

DMPK

−1.43

9.94E−26

1.1 IE−24

RNF181

−1.43

1.88E−42

4.26E−41

GUK1

−1.43

3.52E−94

3.37E−92

GHDC

−1.43

2.52E−15

1.47E−14

GRAMD1A

−1.43

1.76E−70

9.52E−69

SYTL2

−1.43

3.67E−25

3.98E−24

LEPR

−1.43

7.79E−22

7.01E−21

FLJ22184

−1.43

9.59E−18

6.57E−17

EXOSC9

−1.42

5.87E−47

1.59E−45

MMAB

−1.42

2.1 IE−37

4.00E−36

KRT86

−1.42

1.20E−05

2.96E−05

ABHD1

−1.42

7.52E−08

2.34E−07

HOOK2

−1.42

1.59E−22

1.48E−21

PCSK4

−1.42

1.40E−10

5.56E−10

TMC6

−1.42

1.82E−28

2.31E−27

GDPD1

−1.42

6.19E−06

1.57E−05

LRRC23

−1.42

5.41E−11

2.25E−10

PION

−1.42

3.83E−12

1.75E−11

BCL7C

−1.42

9.48E−37

1.73E−35

YPEL3

−1.41

2.79E−10

1.08E−09

RAD51B

−1.41

7.17E−15

4.03E−14

ANXA4

−1.41

3.39E−64

1.55E−62

B4GALNT4

−1.41

8.74E−13

4.18E−12

COX7B

−1.41

1.11E−66

5.56E−65

PRKCZ

−1.41

1.76E−15

1.03E−14

RAB4B

−1.41

2.43E−21

2.10E−20

C4orf34

−1.40

1.44E−38

2.81E−37

STXIO

−1.40

2.42E−15

1.41E−14

CRELD2

−1.40

5.50E−24

5.57E−23

ATP5E

−1.39

6.27E−93

5.87E−91

ESD

−1.39

1.48E−75

9.39E−74

MIA-RAB4B

−1.39

1.84E−21

1.61E−20

NDUFA13

−1.39

5.54E−58

2.17E−56

SNX14

−1.39

3.32E−75

2.09E−73

MRPL13

−1.39

2.86E−44

6.97E−43

PTPRH

−1.39

7.14E−18

4.93E−17

BBS5

−1.39

2.36E−32

3.55E−31

LMBRD1

−1.38

4.17E−25

4.50E−24

IQCH

−1.38

4.75E−08

1.51E−07

LMTK3

−1.38

4.13E−14

2.19E−13

MIR497HG

−1.38

6.24E−12

2.81E−11

C6orf70

−1.38

3.13E−25

3.41E−24

FGGY

−1.38

5.12E−07

1.46E−06

UNC5CL

−1.38

1.66E−08

5.52E−08

DUT

−1.38

8.03E−114

1.13E−111

P2RX4

−1.38

2.17E−20

1.76E−19

HHIPL2

−1.38

4.20E−06

1.09E−05

COX5A

−1.38

3.09E−79

2.21E−77

CKLF

−1.37

6.08E−34

9.94E−33

CRYZL1

−1.37

7.16E−27

8.45E−26

GSTM4

−1.37

6.05E−20

4.80E−19

DNAH14

−1.37

3.44E−11

1.45E−10

TCTN1

−1.37

6.80E−12

3.05E−11

CBX3P2

−1.36

2.01E−06

5.42E−06

PTH1R

−1.36

0.000133911

0.000291689

SEMA6C

−1.36

2.31E−09

8.29E−09

PIR

−1.36

2.10E−31

3.03E−30

DRAP1

−1.36

2.70E−101

2.90E−99

SCP2

−1.36

1.15E−12

5.47E−12

GMDS

−1.36

8.89E−18

6.10E−17

FRG1B

−1.36

9.55E−13

4.56E−12

DECR1

−1.35

4.15E−35

7.08E−34

CTAGE5

−1.35

4.25E−40

8.82E−39

NPM3

−1.35

1.82E−40

3.82E−39

AASS

−1.35

2.75E−05

6.49E−05

ZC3H6

−1.35

1.1 IE−29

1.48E−28

C6orf203

−1.35

2.06E−08

6.82E−08

ADAMTS13

−1.35

1.19E−11

5.23E−11

UBXN11

−1.35

2.01E−06

5.42E−06

C10orf54

−1.35

3.00E−63

1.32E−61

LSS

−1.35

7.02E−41

1.49E−39

KLC4

−1.35

7.74E−09

2.66E−08

ITGB3BP

−1.35

6.76E−11

2.78E−10

TKTL1

−1.35

2.72E−12

1.26E−11

C10orf55

−1.34

1.16E−63

5.16E−62

CRELD1

−1.34

1.99E−20

1.62E−19

ADSSL1

−1.34

2.20E−21

1.91E−20

ALKBH7

−1.34

1.62E−27

1.97E−26

AIFM3

−1.34

5.13E−07

1.47E−06

LLGL2

−1.34

2.44E−09

8.76E−09

SLC27A1

−1.34

1.99E−13

9.99E−13

ZBTB8OS

−1.34

5.50E−20

4.37E−19

ANKRD13D

−1.34

7.36E−25

7.86E−24

C6orf57

−1.34

3.31E−07

9.64E−07

GCAT

−1.33

8.16E−10

3.04E−09

TEX9

−1.33

1.32E−05

3.23E−05

MAP2K5

−1.33

9.00E−11

3.66E−10

SLC27A2

−1.33

2.27E−21

1.97E−20

LTBP3

−1.33

2.53E−43

5.95E−42

LOC100287559

−1.33

4.09E−05

9.47E−05

IFITM10

−1.33

9.64E−09

3.28E−08

CRYL1

−1.33

6.22E−10

2.34E−09

USH1C

−1.33

4.48E−09

1.57E−08

ZC3H12D

−1.33

0.000330901

0.000684453

ERI2

−1.32

7.33E−09

2.53E−08

TBX6

−1.32

0.000899671

0.001760238

WBSCR22

−1.32

1.53E−55

5.53E−54

GNB2L1

−1.32

2.65E−272

1.40E−269

LOC100131089

−1.32

3.24E−08

1.05E−07

EGFL7

−1.32

8.28E−37

1.52E−35

PIM3

−1.31

6.31E−67

3.18E−65

NUCB1

−1.31

1.86E−79

1.34E−77

FDXR

−1.31

1.08E−19

8.38E−19

EMID1

−1.31

2.72E−09

9.72E−09

PIBF1

−1.31

2.54E−16

1.58E−15

HIBCH

−1.30

1.13E−15

6.72E−15

RPS7

−1.30

4.23E−158

1.05E−155

BIK

−1.30

5.76E−06

1.47E−05

TCP11L2

−1.30

9.98E−07

2.77E−06

TSNAX-DISC1

−1.30

6.33E−22

5.72E−21

OMA1

−1.30

1.35E−25

1.50E−24

LOC100506990

−1.30

3.51E−09

1.24E−08

TSTD1

−1.30

7.46E−28

9.23E−27

KISS1R

−1.30

0.000386067

0.000792495

BCKDHA

−1.29

2.10E−43

4.98E−42

B9D1

−1.29

3.14E−13

1.56E−12

ZNF695

−1.29

8.45E−10

3.14E−09

TMEM63B

−1.29

2.19E−69

1.17E−67

MOSPD3

−1.29

8.70E−19

6.37E−18

RNASE4

−1.29

2.00E−27

2.42E−26

UGGT2

−1.29

6.04E−21

5.06E−20

SEMA3F

−1.29

2.32E−19

1.77E−18

RPS24

−1.29

6.92E−214

2.83E−211

DAK

−1.29

4.77E−62

2.04E−60

LOC100130691

−1.29

0.000198722

0.0004236

CTU2

−1.29

1.68E−13

8.48E−13

PLD3

−1.29

7.26E−45

1.81E−43

RHOV

−1.29

2.06E−15

1.20E−14

CHPT1

−1.29

5.19E−67

2.64E−65

ACSM3

−1.29

3.03E−11

1.29E−10

RPS25

−1.28

4.03E−185

1.31E−182

OASL

−1.28

2.48E−11

1.06E−10

RPLP1

−1.28

7.23E−219

3.05E−216

C19orf79

−1.28

2.43E−11

1.04E−10

IL20RB

−1.28

1.18E−09

4.32E−09

CACNG6

−1.28

1.23E−05

3.02E−05

TBCE

−1.28

1.40E−28

1.78E−27

FBXO16

−1.28

0.00019181

0.000409623

LOC100505549

−1.28

9.29E−06

2.31E−05

LOC100507218

−1.28

0.000213956

0.000453549

TLR5

−1.28

0.000112273

0.000247109

EML2

−1.28

1.54E−14

8.42E−14

NPM1

−1.28

3.12E−138

6.48E−136

GAA

−1.28

1.30E−32

1.99E−31

NKD2

−1.28

4.23E−10

1.61E−09

CRIP2

−1.28

8.19E−11

3.34E−10

LOC100132891

−1.27

6.71E−07

1.89E−06

ALG5

−1.27

2.16E−16

1.35E−15

PXK

−1.27

1.02E−14

5.67E−14

ADA

−1.27

6.1 IE−14

3.20E−13

GALE

−1.27

3.38E−45

8.55E−44

PHGDH

−1.27

3.96E−113

5.44E−111

CREG2

−1.27

0.000426556

0.000871508

MSLN

−1.27

2.53E−19

1.93E−18

GDPD5

−1.27

1.22E−12

5.80E−12

ITGA7

−1.27

5.07E−06

1.30E−05

LIG1

−1.27

1.36E−27

1.66E−26

LRTOMT

−1.26

4.37E−06

1.13E−05

C17orf49

−1.26

1.37E−44

3.39E−43

HMGN5

−1.26

5.93E−07

1.69E−06

LOC100505624

−1.26

4.04E−10

1.55E−09

CATSPER1

−1.25

0.000949224

0.00184719

TLE2

−1.25

2.35E−16

1.46E−15

CES3

−1.25

5.98E−07

1.70E−06

TTC35

−1.25

7.52E−30

1.01E−28

C6orf72

−1.25

2.65E−33

4.23E−32

RPS19

−1.25

1.01E−168

2.84E−166

EVI5L

−1.25

3.82E−23

3.68E−22

LOC81691

−1.25

7.76E−11

3.17E−10

PLEKHH3

−1.25

5.91E−39

1.17E−37

LOC100507501

−1.24

1.34E−06

3.67E−06

SLC25A5-AS1

−1.24

2.22E−20

1.80E−19

RPS8

−1.24

1.41E−201

5.25E−199

PPP1R7

−1.24

3.54E−37

6.58E−36

MAGED2

−1.24

4.04E−41

8.64E−40

CSTF3

−1.24

1.10E−12

5.24E−12

LINC00467

−1.24

1.39E−17

9.42E−17

MAD2L2

−1.24

4.26E−29

5.54E−28

PCCB

−1.24

2.05E−53

6.87E−52

SEZ6L2

−1.24

1.72E−27

2.09E−26

FKBP2

−1.24

8.99E−30

1.20E−28

DOCK6

−1.24

4.80E−35

8.13E−34

WIPI1

−1.24

2.07E−06

5.57E−06

ECH1

−1.23

5.12E−76

3.32E−74

OCEL1

−1.23

7.19E−14

3.74E−13

ZNF385C

−1.23

2.37E−06

6.31E−06

ATP8B3

−1.23

6.42E−24

6.47E−23

PAFAH1B2

−1.23

8.05E−25

8.57E−24

TM4SF19-TCTEX1D

−1.23

1.23E−05

3.02E−05

SRPX

−1.23

5.84E−11

2.42E−10

SLC39A11

−1.23

3.03E−21

2.60E−20

TMEM41B

−1.22

5.82E−09

2.02E−08

PADI2

−1.22

3.51E−11

1.48E−10

STX4

−1.22

8.39E−28

1.03E−26

MAP4K2

−1.22

1.86E−20

1.51E−19

PXMP4

−1.22

2.50E−07

7.39E−07

TCIRG1

−1.22

2.38E−41

5.15E−40

SERPING1

−1.22

8.23E−08

2.55E−07

IFI35

−1.22

4.92E−13

2.41E−12

DPY19L1P1

−1.22

3.99E−07

1.15E−06

MAN2B1

−1.22

5.94E−48

1.67E−46

FAF1

−1.22

5.28E−51

1.65E−49

ZDHHC1

−1.22

2.34E−06

6.25E−06

NAAA

−1.21

4.63E−11

1.93E−10

EFCAB11

−1.21

4.21E−05

9.73E−05

HSCB

−1.21

1.67E−12

7.85E−12

FBXW9

−1.21

2.21E−05

5.28E−05

ZNF467

−1.21

1.19E−09

4.36E−09

ILVBL

−1.21

1.32E−44

3.28E−43

SDR16C5

−1.21

4.72E−17

3.09E−16

IQGAP2

−1.21

6.21E−07

1.76E−06

SRGAP3

−1.21

2.76E−05

6.50E−05

EGF

−1.21

0.000108319

0.000238866

ERGIC3

−1.21

2.97E−63

1.31E−61

CYFIP2

−1.21

3.35E−14

1.79E−13

BCAS3

−1.21

5.34E−23

5.11E−22

DOCK11

−1.21

3.15E−11

1.33E−10

SLC37A1

−1.21

1.67E−07

5.02E−07

HSD17B4

−1.21

1.16E−54

4.10E−53

NT5M

−1.21

7.71E−05

0.000172918

SERINC5

−1.20

2.82E−06

7.46E−06

CCDC85B

−1.20

9.58E−95

9.54E−93

ALDH7A1

−1.20

1.18E−61

5.00E−60

OPLAH

−1.20

1.60E−21

1.41E−20

ASNS

−1.20

4.29E−106

5.17E−104

KIFAP3

−1.20

4.03E−26

4.60E−25

C1R

−1.20

2.83E−07

8.29E−07

FRY

−1.20

0.000920901

0.001797881

ANO9

−1.20

7.19E−07

2.02E−06

BCAM

−1.20

7.19E−33

1.1 IE−31

MED30

−1.20

1.06E−13

5.46E−13

LOC100127983

−1.20

6.85E−06

1.73E−05

CBS

−1.20

1.10E−55

4.00E−54

PNPLA2

−1.19

7.09E−37

1.30E−35

C1QL4

−1.19

1.08E−07

3.32E−07

LOC100129716

−1.19

0.000363791

0.000749078

ANKRD36BP2

−1.19

0.000287863

0.000599766

LCMT1

−1.19

7.16E−13

3.45E−12

SHF

−1.19

3.46E−06

9.04E−06

RABGGTA

−1.19

2.76E−10

1.07E−09

ANKRA2

−1.19

4.84E−15

2.76E−14

SYT12

−1.19

8.47E−20

6.64E−19

PYROXD2

−1.19

2.34E−06

6.25E−06

COPG2

−1.19

2.42E−35

4.16E−34

RAP1GAP

−1.19

1.26E−08

4.24E−08

LOC728743

−1.18

2.13E−05

5.11E−05

SRI

−1.18

5.42E−43

1.27E−41

DDX43

−1.18

2.82E−23

2.74E−22

PRIM1

−1.18

1.39E−29

1.85E−28

FAM125A

−1.18

2.67E−16

1.65E−15

HCFC1R1

−1.18

6.80E−52

2.20E−50

THBS3

−1.18

3.57E−18

2.51E−17

C15orf48

−1.18

6.58E−30

8.85E−29

C11orf54

−1.18

7.03E−18

4.86E−17

CTSF

−1.18

5.63E−26

6.40E−25

CDH3

−1.18

4.89E−59

1.96E−57

ULK4

−1.18

0.000777011

0.001532576

C1S

−1.17

6.98E−05

0.00015741

VSIG1

−1.17

0.000372512

0.00076579

MED25

−1.17

6.05E−19

4.47E−18

AIG1

−1.17

7.65E−17

4.93E−16

VAV1

−1.17

2.41E−14

1.30E−13

PPA2

−1.17

1.32E−33

2.13E−32

FAM98C

−1.17

5.33E−05

0.000121815

FCGRT

−1.17

1.69E−26

1.95E−25

EXOSC8

−1.17

1.71E−25

1.88E−24

TMEM160

−1.17

1.88E−11

8.15E−11

SREBF1

−1.17

2.51E−32

3.78E−31

Clorf172

−1.17

8.99E−06

2.24E−05

MSI2

−1.17

1.73E−11

7.52E−11

IMPA2

−1.17

6.70E−36

1.17E−34

IGFBP6

−1.17

1.04E−18

7.55E−18

EIF2D

−1.17

7.55E−48

2.12E−46

LTA4H

−1.16

7.60E−76

4.88E−74

ASL

−1.16

7.72E−28

9.53E−27

ETHE1

−1.16

1.72E−23

1.69E−22

RPH3AL

−1.16

4.72E−21

3.99E−20

KLHDC2

−1.16

2.62E−74

1.59E−72

FAM171A2

−1.16

2.02E−09

7.29E−09

IFT88

−1.16

2.41E−07

7.15E−07

SIGIRR

−1.16

1.53E−05

3.72E−05

SUGT1

−1.16

1.60E−19

1.23E−18

TXNIP

−1.16

3.34E−07

9.72E−07

GTF2H2D

−1.16

0.000102722

0.000227077

REEP6

−1.15

1.93E−18

1.38E−17

AAAS

−1.15

5.67E−34

9.29E−33

CDKL2

−1.15

0.000611109

0.001221929

MRC2

−1.15

2.67E−32

4.02E−31

RPN2

−1.15

4.07E−177

1.26E−174

FN3K

−1.15

5.62E−11

2.33E−10

ST14

−1.15

5.82E−11

2.41E−10

GRAPL

−1.15

0.002321122

0.004253204

CUEDC2

−1.15

2.06E−28

2.59E−27

IFI30

−1.15

1.81E−08

6.01E−08

C9orf46

−1.15

1.24E−12

5.89E−12

ABCA5

−1.15

1.85E−07

5.53E−07

RPGR

−1.15

2.48E−07

7.34E−07

PKN1

−1.15

2.23E−84

1.80E−82

ATG16L2

−1.15

1.06E−06

2.95E−06

WBSCR27

−1.15

3.77E−06

9.80E−06

LRRC45

−1.14

1.24E−17

8.40E−17

PTMS

−1.14

1.81E−79

1.31E−77

CKLF-CMTM1

−1.14

1.06E−16

6.72E−16

BTC

−1.14

3.10E−05

7.27E−05

TNFSF12-TNFS”13

−1.14

7.55E−19

5.53E−18

PREX1

−1.14

4.53E−09

1.58E−08

FGD3

−1.14

7.45E−05

0.000167354

PCIF1

−1.14

2.14E−34

3.56E−33

CALB2

−1.14

3.17E−06

8.33E−06

PTGES

−1.14

3.74E−21

3.18E−20

HES7

−1.13

0.003803794

0.00674057

FGFR4

−1.13

8.06E−24

8.07E−23

NFKBID

−1.13

0.00094651

0.001842867

BMP1

−1.13

1.37E−31

2.00E−30

MSI1

−1.13

0.002464428

0.004500152

RPS6KB2

−1.13

2.74E−20

2.21E−19

KCTD19

−1.13

3.06E−06

8.06E−06

CCDC88B

−1.13

1.55E−11

6.73E−11

SCNN1A

−1.13

4.23E−35

7.21E−34

POMGNT1

−1.13

8.85E−41

1.88E−39

HECTD2

−1.13

0.001588305

0.002987874

NUP107

−1.13

2.10E−54

7.31E−53

CXCL16

−1.13

5.14E−12

2.33E−11

GAPDHS

−1.13

0.001914622

0.003556771

CDC42BPG

−1.13

3.79E−08

1.22E−07

MLXIPL

−1.12

6.00E−06

1.53E−05

IFI27L1

−1.12

1.31E−13

6.68E−13

ABCA7

−1.12

5.03E−32

7.44E−31

CREB3L4

−1.12

8.76E−17

5.61E−16

COPE

−1.12

1.68E−31

2.44E−30

PEMT

−1.12

4.08E−08

1.31E−07

PKN3

−1.12

2.05E−12

9.57E−12

UQCRC1

−1.12

3.06E−84

2.42E−82

DNAJC4

−1.12

2.58E−15

1.50E−14

FAM175A

−1.12

3.67E−05

8.54E−05

FIBP

−1.12

1.34E−48

3.86E−47

KCNN1

−1.12

1.14E−05

2.82E−05

RQCD1

−1.12

5.66E−19

4.19E−18

JUNB

−1.11

9.88E−50

2.95E−48

ASPSCR1

−1.11

5.66E−13

2.76E−12

QPCTL

−1.11

4.68E−25

5.04E−24

CD9

−1.11

3.02E−94

2.91E−92

SH2B2

−1.11

6.68E−05

0.000151083

SSR4

−1.11

1.05E−19

8.16E−19

NDUFA2

−1.11

8.18E−19

5.99E−18

ALPK1

−1.11

1.89E−16

1.19E−15

GFM2

−1.11

1.22E−54

4.29E−53

GPCPD1

−1.11

8.79E−19

6.43E−18

NDRG2

−1.11

1.37E−06

3.74E−06

PRSS22

−1.11

0.002080435

0.003844256

MST1P9

−1.11

0.002266527

0.004161499

TRIM9

−1.11

0.000204924

0.000435644

ATP2A3

−1.11

4.09E−09

1.44E−08

TMEM161A

−1.11

2.06E−12

9.63E−12

ING4

−1.11

5.53E−08

1.75E−07

METTL5

−1.11

9.00E−34

1.46E−32

IFT74

−1.11

2.99E−11

1.27E−10

GALT

−1.10

9.23E−14

4.76E−13

ZCWPW2

−1.10

2.10E−32

3.17E−31

USH1G

−1.10

0.002619829

0.004769462

FAM162A

−1.10

1.90E−18

1.36E−17

BCL3

−1.10

3.72E−46

9.84E−45

TSPAN1

−1.10

9.28E−12

4.1 IE−11

SIPA1

−1.10

2.57E−25

2.80E−24

WDR27

−1.10

8.86E−07

2.47E−06

LOC678655

−1.10

2.98E−09

1.06E−08

MATN2

−1.10

3.00E−17

1.98E−16

SERPINI1

−1.10

7.67E−07

2.15E−06

NPRL2

−1.10

8.74E−12

3.88E−11

IRF6

−1.10

3.53E−11

1.49E−10

C17orf57

−1.10

9.25E−06

2.30E−05

HSPB11

−1.10

2.47E−11

1.06E−10

LOXL2

−1.10

2.56E−119

4.1 IE−117

GATS

−1.10

3.88E−07

1.12E−06

POLD1

−1.10

3.61E−38

6.98E−37

KREMEN2

−1.10

0.000906345

0.001771925

SH3YL1

−1.09

7.15E−18

4.93E−17

HEXDC

−1.09

3.33E−08

1.08E−07

CHIC2

−1.09

5.08E−05

0.000116308

FLJ39051

−1.09

0.000444045

0.000904903

ALKBH6

−1.09

4.88E−09

1.70E−08

MAGOH

−1.09

1.09E−14

6.06E−14

LOC100505783

−1.09

1.52E−05

3.70E−05

C16orf62

−1.09

1.35E−24

1.42E−23

GAL3ST1

−1.09

0.004091279

0.00721967

ZNF670-ZNF695

−1.09

6.71E−07

1.89E−06

UGCG

−1.09

2.19E−49

6.44E−48

AS3MT

−1.09

0.000326442

0.000675804

GRTP1

−1.09

2.37E−05

5.64E−05

AQP3

−1.09

3.02E−08

9.82E−08

TMEM45B

−1.09

7.62E−14

3.95E−13

ZP3

−1.09

2.43E−08

7.96E−08

AP4M1

−1.09

8.43E−09

2.89E−08

PLD1

−1.09

2.70E−06

7.14E−06

CCBL2

−1.09

2.76E−20

2.23E−19

NR4A1

−1.08

4.86E−21

4.10E−20

BRE

−1.08

1.97E−33

3.15E−32

PCYOX1L

−1.08

3.06E−15

1.77E−14

KIAA1456

−1.08

4.80E−05

0.000110264

AARS

−1.08

1.30E−192

4.43E−190

MRPL47

−1.08

2.55E−16

1.58E−15

ERP44

−1.08

4.10E−42

9.20E−41

ARHGEF16

−1.08

5.13E−13

2.51E−12

TP53TG1

−1.08

1.83E−05

4.40E−05

FA2H

−1.08

1.77E−08

5.89E−08

ADAM15

−1.07

4.71E−73

2.73E−71

STAG3

−1.07

0.005718352

0.00986248

PTK2B

−1.07

4.07E−14

2.16E−13

NSMCE1

−1.07

5.38E−18

3.74E−17

ATXNIO

−1.07

9.31E−82

6.97E−80

CCDC53

−1.07

3.48E−15

2.01E−14

MIPEP

−1.07

4.92E−10

1.87E−09

TNFAIP2

−1.07

1.57E−146

3.48E−144

PSMA5

−1.07

1.18E−41

2.60E−40

INSIG1

−1.07

8.19E−55

2.90E−53

KIAA1383

−1.07

4.15E−06

1.07E−05

SDC2

−1.07

3.27E−05

7.64E−05

COX5B

−1.07

7.29E−32

1.08E−30

DTX4

−1.07

2.75E−06

7.28E−06

LOC100289495

−1.07

7.59E−05

0.000170296

BIN1

−1.07

8.92E−11

3.62E−10

CLDN7

−1.07

2.52E−17

1.68E−16

LMF1

−1.07

1.18E−05

2.90E−05

C11orf93

−1.07

0.000180253

0.000386051

C1RL

−1.06

2.49E−30

3.42E−29

MTMR11

−1.06

8.82E−20

6.91E−19

CST6

−1.06

4.12E−16

2.53E−15

CRISPLD1

−1.06

1.71E−07

5.16E−07

PFKL

−1.06

3.28E−73

1.92E−71

IER5L

−1.06

1.03E−19

8.04E−19

NUDT17

−1.06

2.65E−07

7.80E−07

RABAC1

−1.06

9.34E−31

1.31E−29

ABCA2

−1.06

2.56E−49

7.50E−48

TRAP1

−1.06

1.61E−76

1.05E−74

BBS9

−1.06

1.98E−11

8.56E−11

MMP15

−1.06

3.72E−27

4.45E−26

SCPEP1

−1.06

4.13E−22

3.76E−21

TLL2

−1.06

4.28E−05

9.90E−05

VPS28

−1.06

3.44E−19

2.60E−18

TCN2

−1.06

9.31E−07

2.59E−06

HS1BP3

−1.06

5.55E−20

4.41E−19

HMG20B

−1.06

9.18E−84

7.22E−82

FUCA1

−1.06

4.76E−18

3.32E−17

ARHGEF7

−1.05

1.63E−11

7.10E−11

WDR33

−1.05

6.18E−10

2.33E−09

SYT13

−1.05

0.004669962

0.008171303

C16orf13

−1.05

3.16E−24

3.26E−23

KTN1

−1.05

6.31E−91

5.75E−89

GPX4

−1.05

4.33E−82

3.26E−80

RPS16

−1.05

2.85E−107

3.46E−105

AGXT2L2

−1.05

1.67E−12

7.88E−12

TMEM141

−1.05

1.52E−18

1.09E−17

LAMP3

−1.05

4.66E−06

1.20E−05

CDKN1C

−1.05

0.000424019

0.000866884

LOC100288846

−1.05

0.000988006

0.001917938

DHRS12

−1.05

0.008237024

0.013823818

ATP6AP1L

−1.05

0.008191315

0.013754406

ERCC2

−1.05

4.13E−23

3.98E−22

FMO5

−1.05

0.008652057

0.014449416

ULK2

−1.05

8.06E−20

6.33E−19

SMARCD3

−1.05

2.06E−08

6.82E−08

PHYHD1

−1.05

4.25E−11

1.78E−10

C10orf11

−1.05

0.003354135

0.006000913

KRTCAP3

−1.05

0.000203547

0.000433154

SRP54

−1.05

2.70E−88

2.32E−86

IMMP2L

−1.04

2.06E−07

6.13E−07

CARS

−1.04

3.50E−44

8.52E−43

RPL24

−1.04

5.98E−76

3.86E−74

GSN

−1.04

3.51E−17

2.31E−16

BAI2

−1.04

9.31E−16

5.58E−15

WDR18

−1.04

1.17E−46

3.16E−45

ZC4H2

−1.04

0.009400904

0.015597066

EIF3M

−1.04

4.78E−59

1.93E−57

SLC25A42

−1.04

7.39E−08

2.30E−07

MTHFR

−1.04

2.62E−10

1.02E−09

ABCG2

−1.04

0.003349706

0.005994684

NR1H3

−1.04

0.000505923

0.001023253

PAAF1

−1.04

2.18E−21

1.90E−20

GSTK1

−1.04

1.65E−37

3.13E−36

DEPDC4

−1.04

0.000125031

0.000273146

ZNF396

−1.04

2.31E−05

5.51E−05

BHLHE40

−1.04

2.30E−66

1.15E−64

TECPR1

−1.04

3.48E−13

1.72E−12

AMN1

−1.04

1.59E−07

4.80E−07

NTPCR

−1.04

3.26E−21

2.79E−20

MVD

−1.04

5.49E−40

1.13E−38

RRAS

−1.04

1.37E−24

1.44E−23

LOC144481

−1.03

0.001555384

0.00293074

SURF1

−1.03

1.48E−25

1.64E−24

MFF

−1.03

1.03E−98

1.09E−96

MAGED1

−1.03

3.74E−72

2.11E−70

TBL3

−1.03

7.98E−25

8.51E−24

DYX1C1

−1.03

0.000142357

0.000309076

SLC16A5

−1.03

2.35E−23

2.30E−22

GPRIN2

−1.03

1.03E−10

4.17E−10

LOC100130015

−1.03

2.39E−07

7.07E−07

DDX60

−1.03

0.000267213

0.000559136

MITD1

−1.03

1.44E−11

6.27E−11

RBP1

−1.03

0.006467371

0.011039757

TBCA

−1.03

5.18E−33

8.15E−32

ICAM5

−1.03

5.23E−14

2.75E−13

TNFRSF10C

−1.03

0.00023491

0.000494816

CPE

−1.03

7.1 IE−14

3.70E−13

ANK2

−1.03

3.67E−11

1.54E−10

C22orf26

−1.03

0.000452354

0.000920647

SNX2

−1.03

6.73E−33

1.04E−31

ANXA3

−1.03

1.06E−78

7.48E−77

C15orf58

−1.02

0.00133034

0.002534258

RBX1

−1.02

1.31E−21

1.16E−20

ABCD1

−1.02

4.71E−08

1.50E−07

P4HA3

−1.02

0.000276213

0.00057711

KRBA2

−1.02

0.004111753

0.007253308

GLS2

−1.02

0.000259768

0.000544639

ENDOG

−1.02

5.93E−08

1.87E−07

COX7C

−1.02

6.09E−67

3.08E−65

C8orf59

−1.02

2.88E−20

2.32E−19

RAB11FIP4

−1.02

6.08E−09

2.11E−08

CDKL1

−1.02

8.11E−06

2.03E−05

LOC100133957

−1.02

0.001919501

0.003564787

DENND1A

−1.02

5.20E−33

8.18E−32

TRAM1

−1.02

1.47E−76

9.69E−75

UPK3B

−1.02

9.22E−07

2.56E−06

ANKRD29

−1.02

1.13E−27

1.38E−26

CHMP5

−1.02

7.09E−56

2.61E−54

CCDC125

−1.02

4.05E−07

1.17E−06

MEF2BNB-MEF2B

−1.01

0.000476068

0.000966579

PTPRE

−1.01

2.62E−47

7.25E−46

MAGIX

−1.01

0.012672093

0.020531485

MDP1

−1.01

0.000316356

0.000656213

SEMA4G

−1.01

2.18E−21

1.90E−20

TRMT11

−1.01

7.49E−10

2.80E−09

TNFRSF9

−1.01

0.001333696

0.002540269

AMZ2P1

−1.01

1.77E−07

5.32E−07

C7orf10

−1.01

0.000709162

0.001406426

PRPF40B

−1.01

5.32E−24

5.39E−23

NCOA7

−1.01

8.97E−40

1.84E−38

MPND

−1.01

0.000182363

0.000390505

C17orf28

−1.01

1.33E−07

4.04E−07

PFDN5

−1.01

1.94E−57

7.44E−56

VWA1

−1.01

1.13E−18

8.22E−18

VPS33B

−1.01

4.79E−11

2.00E−10

PHYHIP

−1.00

2.49E−07

7.35E−07

SUSD2

−1.00

2.55E−29

3.35E−28

CCNA1

−1.00

1.64E−08

5.47E−08

GAMT

−1.00

4.53E−10

1.72E−09

SLC44A2

−1.00

2.72E−41

5.85E−40

ODF2L

−1.00

2.38E−16

1.48E−15

HIST1H1C

−1.00

2.07E−43

4.93E−42

TAF10

−1.00

6.64E−28

8.23E−27

AKT3

−1.00

7.55E−14

3.92E−13

MACROD2

−1.00

0.008868792

0.014782098

ADAM23

−1.00

1.90E−08

6.31E−08

COQ6

−1.00

2.59E−13

1.29E−12

DLEU2

−1.00

0.005572257

0.009628891

CAT

−1.00

1.55E−30

2.14E−29

MSMO1

−1.00

4.14E−33

6.57E−32

LOC100506334

−1.00

3.11E−06

8.17E−06

TARS2

−1.00

2.70E−38

5.25E−37

P4HTM

−1.00

1.17E−15

6.93E−15

EBF4

−1.00

0.001175315

0.002258326

ARHGEF26-AS1

−1.00

0.000118469

0.000259887

OSGEPL1

−1.00

1.23E−11

5.41E−11

PPFIA3

−1.00

2.52E−05

5.96E−05

C19orf71

−1.00

1.03E−05

2.56E−05

CECR2

−1.00

0.000117675

0.000258236

NAT14

−0.99

1.20E−13

6.15E−13

FADS2

−0.99

2.47E−79

1.77E−77

CALCOCOl

−0.99

3.84E−18

2.69E−17

APOL1

−0.99

0.000590629

0.001183409

ITFG3

−0.99

2.53E−39

5.08E−38

KDELC1

−0.99

1.11E−06

3.05E−06

RPL3

−0.99

1.72E−158

4.35E−156

PLCL2

0.99

1.02E−08

3.47E−08

AOC2

0.99

5.20E−07

1.48E−06

ZBTB2

0.99

3.55E−64

1.61E−62

LOC387647

0.99

2.94E−28

3.68E−27

GDF11

0.99

1.84E−42

4.17E−41

LOC100130992

0.99

6.14E−14

3.21E−13

ZNF407

0.99

1.38E−21

1.22E−20

LOC100288615

0.99

2.15E−11

9.26E−11

TEX15

0.99

1.21E−49

3.59E−48

PMS2P5

0.99

2.22E−10

8.68E−10

TSPYL4

1.00

3.02E−31

4.33E−30

FICD

1.00

4.01E−07

1.16E−06

ZNF587

1.00

3.63E−30

4.94E−29

ANKRD50

1.00

4.80E−50

1.46E−48

NR5A2

1.00

3.61E−06

9.42E−06

ZBTB40

1.00

9.91E−30

1.32E−28

SLAMF7

1.00

1.57E−11

6.83E−11

LOC100129046

1.00

2.73E−07

8.03E−07

PHLPP2

1.00

2.77E−38

5.37E−37

ZNF267

1.00

7.57E−20

5.95E−19

FLNC

1.00

9.43E−158

2.29E−155

ZNF850

1.00

1.62E−14

8.85E−14

HOXB6

1.00

7.96E−27

9.37E−26

RNF34

1.00

6.70E−44

1.61E−42

FOXO3

1.01

5.30E−30

7.17E−29

HUS1

1.01

1.05E−20

8.65E−20

ZNF185

1.01

1.74E−82

1.33E−80

GJA1

1.01

6.19E−16

3.75E−15

AP1S2

1.01

1.54E−19

1.19E−18

TUBB2A

1.01

9.33E−18

6.40E−17

IL16

1.01

0.000167472

0.000360202

ZNF799

1.02

1.30E−09

4.76E−09

LOC100505648

1.02

0.000565896

0.001136915

FAM160A1

1.02

0.004606923

0.008071049

KCTD7

1.02

8.21E−16

4.95E−15

ZNF271

1.02

7.41E−78

5.06E−76

LOC401588

1.02

7.86E−08

2.44E−07

EIF5A

1.02

1.72E−190

5.72E−188

ABHD16B

1.02

1.13E−13

5.79E−13

NBPF15

1.03

4.54E−51

1.43E−49

LOC283922

1.03

0.001810781

0.003376264

GDAP1

1.03

2.93E−52

9.56E−51

KANSL1

1.03

2.80E−09

9.97E−09

HOXB5

1.03

4.62E−16

2.83E−15

LRRC37A4P

1.03

4.01E−19

3.00E−18

RCBTB2

1.04

0.003040041

0.005483952

MYB

1.04

7.95E−05

0.000177891

SLC35F3

1.04

4.08E−27

4.87E−26

LOC100287314

1.04

0.00752343

0.012712245

ZNF33A

1.04

7.90E−65

3.71E−63

TARDBP

1.04

2.43E−135

4.87E−133

FLJ42627

1.04

3.98E−10

1.52E−09

ZNF239

1.04

4.56E−32

6.76E−31

FAM86DP

1.04

1.66E−10

6.54E−10

IL1RL1

1.04

1.54E−08

5.17E−08

ZNF655

1.05

2.40E−34

3.98E−33

ZNF114

1.05

3.01E−18

2.13E−17

FAM35A

1.05

9.15E−46

2.38E−44

SIX2

1.05

0.000341596

0.000705559

ETS1

1.05

3.20E−96

3.24E−94

ERVK13-1

1.05

7.87E−08

2.45E−07

LOC100288123

1.05

0.003598851

0.006403414

SPATA13

1.05

5.28E−19

3.92E−18

PTGER2

1.06

9.55E−10

3.53E−09

METTL12

1.06

1.30E−08

4.37E−08

GNB3

1.06

0.000318505

0.000659914

NOG

1.06

0.001463904

0.002772409

LOC100379224

1.06

1.78E−12

8.34E−12

ZNF514

1.06

2.92E−18

2.07E−17

LOC100506649

1.06

1.27E−46

3.41E−45

CHORDC1

1.07

1.72E−57

6.60E−56

CDKN1A

1.07

7.51E−66

3.68E−64

ARMCX4

1.07

1.38E−14

7.62E−14

NBPF1

1.07

1.78E−24

1.86E−23

TJP2

1.07

8.04E−145

1.75E−142

LOC147804

1.07

1.07E−13

5.51E−13

PRDM13

1.07

2.87E−07

8.40E−07

SON

1.07

2.20E−170

6.31E−168

EPHB2

1.07

6.87E−09

2.37E−08

POM121C

1.08

7.93E−52

2.55E−50

ZNF443

1.08

2.53E−07

7.47E−07

JRK

1.08

7.15E−24

7.18E−23

KBTBD8

1.08

0.000226507

0.000478711

ASB16

1.08

1.81E−06

4.90E−06

FAM86B1

1.08

4.25E−08

1.36E−07

CREB5

1.08

8.91E−16

5.35E−15

VAMP1

1.08

4.97E−14

2.62E−13

USP32P1

1.08

3.37E−24

3.47E−23

IRGQ

1.08

4.72E−37

8.74E−36

RPS26

1.09

8.51E−106

1.02E−103

CLCN4

1.09

2.07E−11

8.92E−11

DPY19L2

1.09

1.60E−06

4.36E−06

TMPPE

1.10

0.000159821

0.000344921

RP9P

1.10

1.53E−14

8.36E−14

ZNF600

1.10

2.10E−16

1.32E−15

C17orf51

1.10

5.46E−47

1.48E−45

ABL2

1.10

6.59E−118

1.02E−115

ZRSR2

1.11

1.52E−05

3.70E−05

ATAD3B

1.11

3.55E−17

2.34E−16

ZBTB26

1.11

5.88E−14

3.08E−13

LOC100527964

1.11

0.000167054

0.00035964

RASSFIO

1.11

0.001652544

0.003100419

WDR52

1.12

0.001376432

0.002616151

ENTPD7

1.12

2.86E−59

1.16E−57

KLHL21

1.12

1.76E−47

4.90E−46

SERPINB7

1.13

5.41E−06

1.39E−05

TFCP2L1

1.13

4.61E−16

2.82E−15

RFTN1

1.13

4.04E−18

2.83E−17

PTHLH

1.13

1.75E−07

5.26E−07

C10rf216

1.13

3.58E−29

4.66E−28

MGC57346

1.13

1.40E−09

5.11E−09

MALAT1

1.14

3.24E−113

4.51E−111

NSUN5P1

1.14

1.10E−06

3.03E−06

C3orf52

1.14

8.59E−13

4.12E−12

MRPS25

1.14

4.61E−67

2.35E−65

C11orf41

1.14

1.89E−08

6.29E−08

EPHA4

1.14

1.27E−05

3.12E−05

LOC283624

1.14

1.05E−22

9.88E−22

FRMD6

1.15

1.79E−118

2.83E−116

XRCC2

1.15

5.36E−36

9.41E−35

ATF5

1.15

7.98E−35

1.34E−33

NOV

1.15

0.000586861

0.00117642

RPL23AP64

1.15

0.000182902

0.00039146

FGF5

1.15

7.83E−05

0.00017528

DNAH17

1.16

5.10E−06

1.31E−05

PPARGC1B

1.16

8.77E−12

3.89E−11

PEA15

1.16

1.76E−127

3.19E−125

MIR22HG

1.16

1.55E−27

1.89E−26

LOC219731

1.16

5.88E−05

0.000133586

SLC7A2

1.16

4.67E−05

0.000107518

ZEB1

1.16

2.44E−37

4.58E−36

MOB3C

1.17

1.91E−22

1.77E−21

SBDSP1

1.17

6.56E−27

7.74E−26

LCAT

1.17

3.08E−08

9.99E−08

HBEGF

1.17

2.63E−45

6.70E−44

MGC70870

1.17

1.69E−109

2.14E−107

CDC42EP2

1.18

6.61E−33

1.03E−31

LOC440300

1.18

1.60E−20

1.31E−19

TMED10P1

1.19

1.35E−14

7.42E−14

B3GALT5

1.19

0.000161499

0.000348482

BMPER

1.19

4.12E−14

2.19E−13

HERC2P7

1.19

1.08E−15

6.44E−15

SEMA3A

1.20

3.81E−10

1.46E−09

HNRNPU-AS1

1.20

1.86E−28

2.35E−27

C20orf118

1.20

1.01E−08

3.43E−08

LOC154761

1.21

1.58E−05

3.84E−05

BTBD6

1.21

3.31E−124

5.74E−122

ALG10

1.21

3.97E−15

2.28E−14

LINC00338

1.22

2.07E−17

1.38E−16

RPL23AP7

1.22

5.87E−08

1.85E−07

CLDN15

1.22

3.94E−17

2.60E−16

TUBA4A

1.22

3.74E−64

1.69E−62

ZNF860

1.22

8.13E−19

5.96E−18

NBPFIO

1.23

1.33E−13

6.78E−13

EFNB2

1.23

5.00E−20

3.98E−19

C15orf52

1.24

3.83E−77

2.56E−75

RRS1

1.24

1.88E−119

3.05E−117

OXTR

1.24

1.09E−16

6.95E−16

CRMP1

1.25

1.15E−06

3.18E−06

ZNF440

1.25

3.58E−18

2.52E−17

EIF4EBP3

1.26

0.000648201

0.001292417

DUSP7

1.26

1.51E−29

1.99E−28

EXOG

1.26

8.37E−22

7.50E−21

MAMLD1

1.27

1.94E−25

2.14E−24

SMPD3

1.27

6.68E−09

2.31E−08

PNN

1.28

1.20E−105

1.42E−103

PMEPA1

1.28

1.35E−87

1.14E−85

SCARF1

1.29

2.58E−10

1.00E−09

LOC100505815

1.29

1.06E−07

3.24E−07

FBXL19-AS1

1.29

1.55E−13

7.86E−13

HIST1H4H

1.29

1.12E−08

3.80E−08

TUBB

1.30

1.63E−74

9.98E−73

LOC100289230

1.30

0.000190102

0.000406114

FAM111B

1.30

2.83E−117

4.27E−115

ZNF33B

1.30

1.31E−57

5.07E−56

ZNF121

1.30

1.57E−28

1.99E−27

ZNF780A

1.30

1.31E−25

1.45E−24

NEFM

1.30

2.06E−10

8.07E−10

DGCR11

1.30

1.08E−13

5.52E−13

ST20

1.31

5.79E−08

1.83E−07

ADAM1

1.32

7.15E−10

2.68E−09

SRSF1

1.32

1.55E−170

4.54E−168

LOC642846

1.33

2.29E−09

8.22E−09

LOC730755

1.33

4.02E−07

1.16E−06

ZNF594

1.33

2.96E−18

2.10E−17

ITGA2

1.33

7.36E−102

8.02E−100

RRN3P3

1.33

4.14E−10

1.58E−09

MXD1

1.34

2.31E−28

2.90E−27

PKI55

1.35

3.94E−10

1.51E−09

LOC100507433

1.35

9.28E−07

2.58E−06

PPAPDC1A

1.35

5.00E−27

5.95E−26

PIGW

1.35

7.76E−78

5.28E−76

NBPF9

1.35

3.18E−46

8.45E−45

ZNF782

1.36

4.73E−11

1.97E−10

RRP7B

1.36

4.18E−08

1.33E−07

MICA

1.36

1.68E−22

1.56E−21

SCARNA12

1.36

4.69E−05

0.000108075

DDX12P

1.36

1.67E−09

6.07E−09

RPSAP9

1.36

5.75E−08

1.81E−07

PLEKHM1

1.37

2.14E−08

7.05E−08

CLDN1

1.37

1.78E−123

2.99E−121

TUBB1

1.37

1.35E−07

4.10E−07

SERHL

1.37

2.41E−09

8.64E−09

YY2

1.38

1.99E−15

1.16E−14

LOC344595

1.38

8.64E−13

4.14E−12

LOC654342

1.39

1.44E−08

4.83E−08

HCN2

1.39

1.10E−05

2.71E−05

TSSK2

1.39

5.96E−06

1.52E−05

SERTAD4

1.40

4.02E−18

2.81E−17

PTGDR2

1.40

1.65E−14

8.98E−14

HTR7P1

1.40

5.99E−16

3.63E−15

C10rf63

1.41

2.97E−32

4.44E−31

OBFC2A

1.41

1.26E−72

7.20E−71

ICOSLG

1.41

3.58E−23

3.46E−22

PPP1R3E

1.42

8.05E−22

7.22E−21

F13A1

1.42

1.56E−21

1.37E−20

WASH1

1.43

1.32E−13

6.69E−13

GNRH1

1.43

7.51E−09

2.59E−08

TLR2

1.44

2.19E−07

6.50E−07

PXDN

1.45

2.57E−18

1.83E−17

LOX

1.45

4.42E−65

2.1 IE−63

EIF3C

1.46

6.70E−21

5.60E−20

EIF3CL

1.46

6.74E−21

5.62E−20

DHRS4L2

1.46

4.24E−11

1.78E−10

CD274

1.46

6.02E−65

2.85E−63

LOC646329

1.46

4.89E−07

1.40E−06

ZNF767

1.46

6.55E−20

5.19E−19

SPNS2

1.46

4.72E−21

3.99E−20

LOC401431

1.47

1.10E−13

5.62E−13

SHISA7

1.47

1.52E−07

4.60E−07

WASH3P

1.47

1.01E−15

6.05E−15

C12orf34

1.47

6.88E−13

3.32E−12

LOC728643

1.47

6.16E−10

2.32E−09

PI4KAP1

1.48

3.1 IE−15

1.80E−14

HSPA8

1.48

0

0

BCL2A1

1.48

1.71E−11

7.41E−11

ADAMTS6

1.49

3.58E−06

9.33E−06

SPIN2B

1.49

1.12E−09

4.12E−09

TUBAIB

1.49

4.03E−278

2.32E−275

TNFAIP3

1.50

3.05E−159

7.86E−157

CCDC39

1.50

3.75E−05

8.72E−05

WASH5P

1.51

3.91E−50

1.19E−48

SPHK1

1.52

4.08E−27

4.87E−26

ZNF417

1.53

1.87E−17

1.25E−16

LOC100289019

1.53

3.60E−10

1.38E−09

TUBA1C

1.54

0

0

BMS1P5

1.54

2.70E−06

7.16E−06

BMS1P1

1.54

2.71E−06

7.17E−06

SHISA9

1.54

1.40E−48

4.04E−47

SOX9

1.54

1.14E−50

3.52E−49

ENC1

1.55

3.65E−104

4.24E−102

PLEKHA8P1

1.55

4.63E−10

1.76E−09

NEAT1

1.55

2.74E−226

1.24E−223

LOC100506123

1.55

6.41E−12

2.88E−11

LOC100506599

1.56

1.30E−08

4.37E−08

FOXO3B

1.56

4.19E−17

2.76E−16

PDIA3P

1.56

1.88E−19

1.44E−18

MMP1

1.56

6.14E−19

4.53E−18

FERMT1

1.57

9.62E−144

2.06E−141

NPTX2

1.57

2.39E−07

7.07E−07

MSTO2P

1.58

3.96E−15

2.27E−14

ZFP112

1.58

2.53E−18

1.80E−17

AFG3L1P

1.59

3.41E−74

2.05E−72

TFRC

1.60

1.56E−210

6.16E−208

SPRN

1.63

3.15E−21

2.70E−20

LOC100133091

1.64

4.17E−08

1.33E−07

GKN2

1.64

1.01E−19

7.88E−19

LOC100272217

1.64

8.20E−08

2.54E−07

LOC100132247

1.66

1.26E−11

5.53E−11

UBC

1.67

0

0

LOC440894

1.69

4.98E−07

1.42E−06

HERC2P2

1.70

1.86E−84

1.51E−82

CBWD2

1.70

2.67E−09

9.56E−09

DQX1

1.71

1.13E−10

4.53E−10

CHRM3

1.72

1.40E−14

7.68E−14

TMEM158

1.72

1.85E−29

2.44E−28

G0S2

1.73

4.26E−70

2.29E−68

LOC100288778

1.77

5.61E−13

2.74E−12

CCZ1

1.81

6.97E−29

9.02E−28

GPR89A

1.81

6.1 IE−21

5.12E−20

DOK3

1.83

1. OOE−10

4.05E−10

C6orf141

1.85

7.97E−58

3.1 IE−56

NAV3

1.85

1.21E−68

6.33E−67

HERC2P9

1.85

9.07E−20

7.09E−19

GOLGA8B

1.86

5.17E−113

7.03E−111

OPHN1

1.93

1.05E−64

4.92E−63

TAGLN

1.94

2.23E−95

2.24E−93

PRG4

1.95

6.72E−29

8.72E−28

NBPF16

1.95

1.02E−114

1.48E−112

AGAP6

1.96

2.09E−25

2.30E−24

PFN1P2

2.05

1.19E−30

1.65E−29

PPP1R11

2.18

2.28E−16

1.42E−15

HMGA2

2.19

7.78E−56

2.85E−54

SRSFIO

2.22

1.64E−22

1.53E−21

GOLGA8A

2.30

1.62E−88

1.41E−86

LOC100216001

2.32

1.88E−13

9.49E−13

NBPF14

2.34

4.08E−85

3.35E−83

LOC284454

2.42

2.30E−69

1.22E−67

ESM1

2.55

6.08E−25

6.53E−24

LOC613037

2.70

2.83E−23

2.74E−22

GO analysis showed Esrrb-dependent DY131 up-regulated genes were important for regulation of transcription, regulation of apoptosis and proliferation, and a majority of down-regulated genes are related to oxidation and reduction, metabolism and translation elongation (Table 4; Additional file 1: Table S1).
Table 4

Gene ontology analysis of Esrrb-dependent DY131-altered genes

Term (down-regulated genes)

Count

P value

GO:0042273 ~ ribosomal large subunit biogenesis

4

0.007

GO:0006297 ~ nucleotide-excision repair, DNA gap filling

4

0.032

GO:0006541 ~ glutamine metabolic process

4

0.042

GO:0009083 ~ branched chain family amino acid catabolic process

5

0.001

GO:0042274 ~ ribosomal small subunit biogenesis

5

0.001

GO:0009081 ~ branched chain family amino acid metabolic process

5

0.004

GO:0006904 ~ vesicle docking during exocytosis

5

0.016

GO:0048278 ~ vesicle docking

5

0.021

GO:0006958 ~ complement activation, classical pathway

5

0.031

GO:0022406 ~ membrane docking

5

0.038

GO:0002455 ~ humoral immune response mediated by circulating immunoglobulin

6

0.008

GO:0009060 ~ aerobic respiration

6

0.014

GO:0006635 ~ fatty acid beta-oxidation

7

0.001

GO:0009062 ~ fatty acid catabolic process

7

0.003

GO:0019395 ~ fatty acid oxidation

7

0.005

GO:0034440 ~ lipid oxidation

7

0.005

GO:0033559 ~ unsaturated fatty acid metabolic process

7

0.019

GO:0009064 ~ glutamine family amino acid metabolic process

7

0.020

GO:0019228 ~ regulation of action potential in neuron

7

0.024

GO:0006289 ~ nucleotide-excision repair

7

0.026

GO:0051591 ~ response to cAMP to cAMP

8

0.002

GO:0006800 ~ oxygen and reactive oxygen species metabolic process

8

0.021

GO:0001508 ~ regulation of action potential

8

0.023

GO:0009566 ~ fertilization

8

0.046

GO:0044242 ~ cellular lipid catabolic process

9

0.013

GO:0007160 ~ cell–matrix adhesion

9

0.032

GO:0060627 ~ regulation of vesicle-mediated transport

9

0.046

GO:0009063 ~ cellular amino acid catabolic process

10

0.002

GO:0045333 ~ cellular respiration

10

0.020

GO:0007568 ~ aging

10

0.040

GO:0016485 ~ protein processing

10

0.044

GO:0006364 ~ rRNA processing

11

0.005

GO:0016072 ~ rRNA metabolic process

11

0.007

GO:0006887 ~ exocytosis

11

0.022

GO:0009310 ~ amine catabolic process

12

0.000

GO:0008203 ~ cholesterol metabolic process

12

0.001

GO:0016125 ~ sterol metabolic process

12

0.003

GO:0042391 ~ regulation of membrane potential

12

0.024

GO:0015980 ~ energy derivation by oxidation of organic compounds

12

0.038

GO:0042254 ~ ribosome biogenesis

13

0.005

GO:0016053 ~ organic acid biosynthetic process

14

0.013

GO:0046394 ~ carboxylic acid biosynthetic process

14

0.013

GO:0022613 ~ ribonucleoprotein complex biogenesis

14

0.038

GO:0016042 ~ lipid catabolic process

15

0.013

GO:0006457 ~ protein folding

15

0.016

GO:0034470 ~ ncRNA processing

15

0.025

GO:0022900 ~ electron transport chain

16

0.000

GO:0032940 ~ secretion by cell

16

0.026

GO:0016054 ~ organic acid catabolic process

17

0.000

GO:0046395 ~ carboxylic acid catabolic process

17

0.000

GO:0034660 ~ ncRNA metabolic process

19

0.008

GO:0006631 ~ fatty acid metabolic process

21

0.000

GO:0046903 ~ secretion

22

0.014

GO:0006414 ~ translational elongation

25

0.000

GO:0008610 ~ lipid biosynthetic process

26

0.002

GO:0006091 ~ generation of precursor metabolites and energy

31

0.000

GO:0006412 ~ translation

38

0.000

GO:0016192 ~ vesicle-mediated transport

39

0.003

GO:0055114 ~ oxidation reduction

54

0.000

Term (up-regulated genes)

Count

P value

GO:0002220 ~ innate immune response activating cell surface receptor signaling pathway

2

0.045

GO:0048712 ~ negative regulation of astrocyte differentiation

2

0.045

GO:0000724 ~ double-strand break repair via homologous recombination

3

0.020

GO:0000725 ~ recombinational repair

3

0.020

GO:0045987 ~ positive regulation of smooth muscle contraction

4

0.001

GO:0045933 ~ positive regulation of muscle contraction

4

0.002

GO:0006940 ~ regulation of smooth muscle contraction

4

0.009

GO:0050768 ~ negative regulation of neurogenesis

4

0.015

GO:0010721 ~ negative regulation of cell development

4

0.018

GO:0006937 ~ regulation of muscle contraction

4

0.050

GO:0048704 ~ embryonic skeletal system morphogenesis

5

0.004

GO:0048706 ~ embryonic skeletal system development

5

0.012

GO:0031344 ~ regulation of cell projection organization

5

0.019

GO:0007411 ~ axon guidance

5

0.035

GO:0051258 ~ protein polymerization

6

0.000

GO:0043623 ~ cellular protein complex assembly

6

0.039

GO:0050767 ~ regulation of neurogenesis

6

0.042

GO:0048705 ~ skeletal system morphogenesis

7

0.002

GO:0060284 ~ regulation of cell development

7

0.031

GO:0007018 ~ microtubule-based movement

8

0.000

GO:0051960 ~ regulation of nervous system development

8

0.007

GO:0006916 ~ anti-apoptosis

8

0.010

GO:0007017 ~ microtubule-based process

8

0.027

GO:0001501 ~ skeletal system development

9

0.031

GO:0006917 ~ induction of apoptosis

9

0.031

GO:0012502 ~ induction of programmed cell death

9

0.032

GO:0045596 ~ negative regulation of cell differentiation

10

0.001

GO:0040008 ~ regulation of growth

10

0.017

GO:0043066 ~ negative regulation of apoptosis

10

0.021

GO:0043069 ~ negative regulation of programmed cell death

10

0.023

GO:0060548 ~ negative regulation of cell death

10

0.023

GO:0022403 ~ cell cycle phase

10

0.049

GO:0006928 ~ cell motion

12

0.021

GO:0042127 ~ regulation of cell proliferation

17

0.018

GO:0042981 ~ regulation of apoptosis

18

0.011

GO:0043067 ~ regulation of programmed cell death

18

0.012

GO:0010941 ~ regulation of cell death

18

0.012

GO:0006355 ~ regulation of transcription, DNA-dependent

29

0.047

GO:0051252 ~ regulation of RNA metabolic process

30

0.038

GO:0006350 ~ transcription

43

0.000

GO:0045449 ~ regulation of transcription

48

0.001

Discussion

Esrrb has gained lots of attention in recent years because of its biological function in stem cells and its ability to reprogram somatic cells to iPSC with oct4 and sox2 [6, 13, 1721]. Several other functions of Esrrb have also been discovered including alteration of energy balance, estrogen receptor and glucocorticoid receptor transcription function modulation, Keap1-Nrf2 signaling inhibition, and tumorigenesis in prostate cancer and endometrial adenocarcinoma [912, 2225]. But transcriptome-wide Esrrb function and Esrrb-regulated genes in cancer cells are not well studied.

Esrrb was reported by Chan et al. as a tumor suppressor in DU145 and LNCaP prostate cancer cells using both in vitro and in vivo models [9]. Expression of Esrrb induced p21/cdkn1a by directly binding to an ERRE in p21/cdkn1a’s promoter, arrested cell cycle at S-phase, and significantly inhibited cell growth [9, 26]. Interestingly, we did not find p21/cdkn1a up-regulation after Esrrb expression alone, but after we treated DU145 cells with 3 μM DY131, we observed a significant increase of p21/cdkn1a mRNA (Table 3; Additional file 2: Figure S1). Scrutinizing the data revealed that Chan’s lab cultured their cells with full serum, while we used charcoal-stripped serum for cell culture and DY131 treatment [9]. This implies that there is a compound or factor that can be removed by charcoal treatment modulated Esrrb’s activity [27, 28].

From the Esrrb-regulated gene list, we found a few target genes that are related to the known function of Esrrb. Kiaa1199 encoded gene product has been shown to associate with cellular mortality. A kiaa1199 mutation was reported to relate to nonsyndromic hearing loss. Considering the significant effect of Esrrb mutations on human hearing loss, kiaa1199 could be a mediator of Esrrb mutant related hearing loss [2932] [3336]. Another interesting Esrrb responsive gene is tagln (Transgelin). It was inhibited by Esrrb while DY131 treatment relieved the inhibition. Tagln was reported to promote DU145 cell migration and invasion, indicating Esrrb can also affect DU145 cell behavior by affecting tagln [37].

Judging by the numbers of altered genes induced by Esrrb with or without DY131, and the result that DY131 did not alter any mRNA in the absence of Esrrb, we conclude that DY131 activity is Esrrb-dependent.

Conclusions

In conclusion, we characterized the transcriptome alteration induced by Esrrb expression as well as Esrrb with its ligand DY131 in prostate cancer cells. We conclude Esrrb-target synthetic ligand requires Esrrb to generate its gene expression modulation effect. Finally, analysis of Esrrb target genes indicates Esrrb may be an important factor in regulating cell proliferation.

Methods

Cell culture and reagents

DU145 (ATCC Number: HTB-81) and HEK293 (ATCC number: CRL-1571) cells were obtained from the American Type Culture Collection (ATCC). DU145 cells were cultured in RPMI1640 media (Invitrogen, Grand Island, NY, USA) with 10 % Fetal Bovine Serum (FBS) (GE Healthcare Life Sciences, Logan, UT, USA). HEK293 cells were cultured in Eagle’s Minimal Essential Medium (DMEM) (Invitrogen, Grand Island, NY, USA) with 10 % FBS. 70 % confluent DU145 cells were transfected with either pcDNA3.1-zeo (+)-Esrrb expression vector [4], or control empty vector pcDNA3.1-zeo (+) (Promega, Madison, WI, USA). Empty vector or Esrrb expression vector transfected DU145 cells were maintained in medium containing 150 μg/ml Zeocine (Invitrogen, Grand Island, NY, USA) for 3 weeks for selection. Two biological replicates of DU145 cells transfected with Esrrb were pooled together respectively and were named DU145-Esrrb. Two biological replicates of DU145 cells transfected with control vector were pooled together respectively and were named DU145-pc3.1. Total RNA and protein were collected from cells after they are confluent in 60 mm petri dishes, cultured with phenol-red free RPMI1640 with 10 % Charcoal-stripped FBS [38]. For DY131 (Tocris Bioscience, Bristol, UK) treatment, cells are plated in 60 mm petri dishes until confluent; DU145-pc3.1 and DU145-Esrrb are incubated with 3 μM DY131 diluted in medium with charcoal-stripped FBS for indicated length of time.

Western-blot

Total protein was isolated from DU145-pc3.1, and DU145-Esrrb cells. 20 μg protein was loaded on 9 % SDS gels. After the proteins were transferred to nitrocellulose membrane, the membrane was blocked and then incubated with 1:2000 diluted monoclonal anti-Esrrb mouse IgG (R&D system, Cat. no: PP-H6705-00) and 1:2000 diluted polyclonal anti-GPADH rabbit IgG (Santa Cruz, Dallas, TX, USA, Cat. no: sc-25777) at 4 degrees overnight. The membrane was then washed and incubated with anti-mouse or anti-rabbit secondary antibody. Chemoluminescence (Promega, Madison, WI, USA) signals were collected using x-ray films (Fisher Scientific, Pittsburg, PA, USA).

Reverse transcriptase PCR and quantitative PCR

Total RNA was isolated and purified from DU145-pc3.1 and DU145-Esrrb using RNeasy kit (Qiagen, Venlo, Netherlands). 1000 ng of total RNA was used to create cDNA libraries using Superscript III Reverse Transciptase with random primers and oligodT (Invitrogen, Grand Island, NY, USA). Esrrb mRNA concentration was determined using quantitative PCR (qPCR) (iQ SYBR, BioRad, Hercules, CA, USA) on ABI7500 system (Applied Biosystems, Foster City, CA, USA). PCR condition: 95°, 30 s; 60°, 40 s; 72°, 40 s. Each qPCR test was performed three times on each of the two biological replicates. Primer sequences: zcwpw2 (Genbank: NM_001040432): forward primer: AACAGGGTTGTCTGTGAGACGGA; reverse primer: TGCAGGAGCTTCTGGGCTGC. hoxb8 (Genbank: NM_024016): forward primer: GATGCGCC CGCAAGCAGC; reverse primer: CCCAGGGCGTGCGATACCTC. tagln (Genbank: NM_001001522): forward primer: ATGCCCCGGATGACTTGGCT; reverse primer: GCCATGTCTGGGGAAAGCTCCT. f13a1 (Genbank: NM_000129): forward primer: TGTTCCGTGAAATCCGGCCC; reverse primer: TGCACGTCCAG CTCGCCATA. pxdn (Genbank: NM_012293): forward primer: GCAAGCATTTAA GGGACTTGCCTCT; reverse primer: GCAAAAATAGCCTCTCGAGCTTCGG. aox1 (Genbank: NM_001159): forward primer: TACGTGAACGGCCGCAAGGT; reverse primer: TGGCTGGGTGATGCCTTATCCT. bmp4 (Genbank: NM_001202): forward primer: CCACCACGAAGAACA TCTGGAG; reverse primer: GCCCCTTTCCCAATCAGGGC. tgfβ: (Genbank: NM_000660) forward primer: AGTGGACATC AACGGGTTCAC; reverse primer: CGCACGCAGCAGTTCTTCTC. gapdh: (Genbank: NM_001256799); forward primer: ACCCACTCCTCCACCTTTG; reverse primer: CTCTTGTGCTCTTGCTGGG. Esrrb: (Genbank: NM_004452) forward primer: CAAGAAGCTCAAGGTGGAGAAGGAGGAG; reverse primer: CGGTCTGTCC GTTTGTCTGTCTGTAGGT. Esrrg: (Genbank: NM_001134285) forward primer: ACCATGAATGGCCATCAGA A; reverse primer: ACCAGCTGAGGGTTCAGGTAT.

Deep sequencing and differentially expressed genes

2500 ng total RNA from two biological replicates was used to generate cDNA libraries using TruSeq Stranded mRNA Sample Preparation kits (Illumina, San Diego, CA, USA). RNA quality and fragment sizing of cDNA library were determined by the University of Missouri DNA core. Deep sequencing was performed by the MU DNA core using Illumina HiSeq 2000 following the manufacture’s instruction. Briefly, samples (8 total) were pooled into one lane with each sample annealed to a specific indexed adaptor. 50 bp single end reads were generated. For each sample, approximately 18 million reads were generated in.fastq format (NCBI-GEO, accession number: GES71208). The sequencing reads were trimmed and filtered using FASTX-Toolkit (V 0.0.13) (http://hannonlab.cshl.edu/fastx_toolkit), and mapped to genome (UCSC hg18) using TopHat2 [39, 40]. Gene expression values were determined by gene raw read counts using an in-house tool MULTICOM-MAP [4143]. Raw reads were normalized to each sample’s library size and differentially expressed genes were calculated using R/Bioconductor package edgeR [44]. Specifically, we kept the genes that have at least 1 count-per-million (cpm) in at least 2 samples and computed the effective library sizes. Pairwise gene expression tests were carried out using exact test. Differentially expressed genes were determined by log2 fold change (Log2FC) (Log2FC ≥ 1, or Log2FC ≤ −1), p value (p < 0.05) and false discovery rate (FDR < 0.05) [45].

Gene set function enrichment

Gene ontology (GO) analysis was performed using DAVID bioinformatics sources 6.7 [46, 47]. Differentially expressed genes from certain pairwise comparisons were uploaded to DAVID server (http://david.abcc.ncifcrf.gov) and GO analysis were performed for biological process (BP). Minimum counts were set as default value (two counts) and maximum EASE score (p value) was set to 0.05. Differentially expressed genes pathway enrichment analysis was performed using Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway [48, 49]. Gene expression profiles Spearman ranking correlation analysis was analyzed using R (version 3.0.2). Gene expression heat map and hierarchical clustering were created by R/Bioconductor (version 2.13) package gplot.

Statistical analysis

qPCR experiments were performed in triplicate on both biological replicates. T test was employed to statistically analyze whether the differences in gene expression is significant (p < 0.05). Statistical significance of gene set overlap (Venn Diagram) are tested according to previous reported method [17].

Availability of supporting data

The data sets supporting the results of this article are available in the NCBI-GEO repository, accession number: GSE71208, URL: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE71208.

Abbreviations

Esrrb: 

estrogen related receptor beta

ERRE: 

estrogen related receptor response element

SFRE: 

steroid factor response element

iPSC: 

induced pluripotent stem cells

OSKM: 

Oct4, Sox2, Klf4, cMyc

FBS: 

fetal bovine serum

RT: 

reverse transcriptase

KEGG: 

Kyoto encyclopedia of genes and genomes

GO: 

gene ontology

FC: 

fold change

Esrrg: 

estrogen related receptor gamma

Declarations

Authors’ contributions

YL established the model cell line and performed RNA isolation, Esrrb expression status test, western blot, cell growth assay, differentially expressed gene analysis, functional enrichment of gene sets by GO and KEGG pathway, construct gene regulation network and statistical analysis. YL, JL, JC performed sequence alignment and generated the gene expression count table for RNA-seq data analysis. YL and DBL conceived of the study, participated in its design and drafted the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We thank Dr. Wei Zhou for cloning Esrrb. We also thank Nicholas Starkey, Benjamin Merideth and Yufei Li for helpful discussions. This publication or project was made possible in part by Grant Number P50AT006273 from the National Center for Complementary and Integrative Health (NCCIH), the Office of Dietary Supplements (ODS), and the National Cancer Institute (NCI). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NCCAM, ODS, NCI, or the National Institutes of Health.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Biochemistry, University of Missouri
(2)
MU Center for Botanical Interaction Studies, University of Missouri
(3)
Computer Science Department, University of Missouri
(4)
Informatics Institute, University of Missouri
(5)
Xiphophorus Genetic Stock Center, Texas State University

References

  1. Giguere V, Yang N, Segui P, Evans RM. Identification of a new class of steroid hormone receptors. Nature. 1988;331:91–4.View ArticlePubMedGoogle Scholar
  2. Vanacker JM, Pettersson K, Gustafsson JA, Laudet V. Transcriptional targets shared by estrogen receptor-related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta. EMBO J. 1999;18:4270–9.PubMed CentralView ArticlePubMedGoogle Scholar
  3. Luo J, Sladek R, Bader JA, Matthyssen A, Rossant J, et al. Placental abnormalities in mouse embryos lacking the orphan nuclear receptor ERR-beta. Nature. 1997;388:778–82.View ArticlePubMedGoogle Scholar
  4. Zhou W, Liu Z, Wu J, Liu JH, Hyder SM, et al. Identification and characterization of two novel splicing isoforms of human estrogen-related receptor beta. J Clin Endocrinol Metab. 2006;91:569–79.View ArticlePubMedGoogle Scholar
  5. Welstead GG, Brambrink T, Jaenisch R. Generating iPS cells from MEFS through forced expression of Sox-2, Oct-4, c-Myc, and Klf4. J Vis Exp. 2008;14.Google Scholar
  6. Feng B, Jiang J, Kraus P, Ng JH, Heng JC, et al. Reprogramming of fibroblasts into induced pluripotent stem cells with orphan nuclear receptor Esrrb. Nat Cell Biol. 2009;11:197–203.View ArticlePubMedGoogle Scholar
  7. Buganim Y, Faddah DA, Cheng AW, Itskovich E, Markoulaki S, et al. Single-cell expression analyses during cellular reprogramming reveal an early stochastic and a late hierarchic phase. Cell. 2012;150:1209–22.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Cheung CP, Yu S, Wong KB, Chan LW, Lai FM, et al. Expression and functional study of estrogen receptor-related receptors in human prostatic cells and tissues. J Clin Endocrinol Metab. 2005;90:1830–44.View ArticlePubMedGoogle Scholar
  9. Yu S, Wong YC, Wang XH, Ling MT, Ng CF, et al. Orphan nuclear receptor estrogen-related receptor-beta suppresses in vitro and in vivo growth of prostate cancer cells via p21(WAF1/CIP1) induction and as a potential therapeutic target in prostate cancer. Oncogene. 2008;27:3313–28.View ArticlePubMedGoogle Scholar
  10. Fujimura T, Takahashi S, Urano T, Ijichi N, Ikeda K, et al. Differential expression of estrogen-related receptors beta and gamma (ERRbeta and ERRgamma) and their clinical significance in human prostate cancer. Cancer Sci. 2010;101:646–51.View ArticlePubMedGoogle Scholar
  11. Zhou W, Lo SC, Liu JH, Hannink M, Lubahn DB. ERRbeta: a potent inhibitor of Nrf2 transcriptional activity. Mol Cell Endocrinol. 2007;278:52–62.View ArticlePubMedGoogle Scholar
  12. Bombail V, Collins F, Brown P, Saunders PT. Modulation of ER alpha transcriptional activity by the orphan nuclear receptor ERR beta and evidence for differential effects of long- and short-form splice variants. Mol Cell Endocrinol. 2010;314:53–61.View ArticlePubMedGoogle Scholar
  13. Chen X, Xu H, Yuan P, Fang F, Huss M, et al. Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. Cell. 2008;133:1106–17.View ArticlePubMedGoogle Scholar
  14. Ouyang Z, Zhou Q, Wong WH. ChIP-Seq of transcription factors predicts absolute and differential gene expression in embryonic stem cells. Proc Natl Acad Sci USA. 2009;106:21521–6.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Percharde M, Lavial F, Ng JH, Kumar V, Tomaz RA, et al. Ncoa3 functions as an essential Esrrb coactivator to sustain embryonic stem cell self-renewal and reprogramming. Genes Dev. 2012;26:2286–98.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Nishiyama A, Sharov AA, Piao Y, Amano M, Amano T, et al. Systematic repression of transcription factors reveals limited patterns of gene expression changes in ES cells. Sci Rep. 2013;3:1390.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Zhou Q, Chipperfield H, Melton DA, Wong WH. A gene regulatory network in mouse embryonic stem cells. Proc Natl Acad Sci USA. 2007;104:16438–43.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Carter MG, Stagg CA, Falco G, Yoshikawa T, Bassey UC, et al. An in situ hybridization-based screen for heterogeneously expressed genes in mouse ES cells. Gene Expr Patterns. 2008;8:181–98.PubMed CentralView ArticlePubMedGoogle Scholar
  19. van den Berg DL, Zhang W, Yates A, Engelen E, Takacs K, et al. Estrogen-related receptor beta interacts with Oct4 to positively regulate Nanog gene expression. Mol Cell Biol. 2008;28:5986–95.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Zhang X, Zhang J, Wang T, Esteban MA, Pei D. Esrrb activates Oct4 transcription and sustains self-renewal and pluripotency in embryonic stem cells. J Biol Chem. 2008;283:35825–33.View ArticlePubMedGoogle Scholar
  21. Storm MP, Kumpfmueller B, Thompson B, Kolde R, Vilo J, et al. Characterization of the phosphoinositide 3-kinase-dependent transcriptome in murine embryonic stem cells: identification of novel regulators of pluripotency. Stem Cells. 2009;27:764–75.View ArticlePubMedGoogle Scholar
  22. Gao M, Sun P, Wang J, Zhao D, Wei L. Expression of estrogen receptor-related receptor isoforms and clinical significance in endometrial adenocarcinoma. Int J Gynecol Cancer. 2006;16:827–33.View ArticlePubMedGoogle Scholar
  23. Wang SC, Myers S, Dooms C, Capon R, Muscat GE. An ERRbeta/gamma agonist modulates GRalpha expression, and glucocorticoid responsive gene expression in skeletal muscle cells. Mol Cell Endocrinol. 2010;315:146–52.View ArticlePubMedGoogle Scholar
  24. Byerly MS, Al Salayta M, Swanson RD, Kwon K, Peterson JM, et al. Estrogen-related receptor beta deletion modulates whole-body energy balance via estrogen-related receptor gamma and attenuates neuropeptide Y gene expression. Eur J Neurosci. 2013;37:1033–47.PubMed CentralView ArticlePubMedGoogle Scholar
  25. Byerly MS, Swanson RD, Wong GW, Blackshaw S. Estrogen-related receptor beta deficiency alters body composition and response to restraint stress. BMC Physiol. 2013;13:10.PubMed CentralView ArticlePubMedGoogle Scholar
  26. Castet A, Herledan A, Bonnet S, Jalaguier S, Vanacker JM, et al. Receptor-interacting protein 140 differentially regulates estrogen receptor-related receptor transactivation depending on target genes. Mol Endocrinol. 2006;20:1035–47.View ArticlePubMedGoogle Scholar
  27. Sumi D, Ignarro LJ. Estrogen-related receptor alpha 1 up-regulates endothelial nitric oxide synthase expression. Proc Natl Acad Sci USA. 2003;100:14451–6.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Vanacker JM, Bonnelye E, Chopin-Delannoy S, Delmarre C, Cavailles V, et al. Transcriptional activities of the orphan nuclear receptor ERR alpha (estrogen receptor-related receptor-alpha). Mol Endocrinol. 1999;13:764–73.PubMedGoogle Scholar
  29. Abe S, Usami S, Nakamura Y. Mutations in the gene encoding KIAA1199 protein, an inner-ear protein expressed in Deiters’ cells and the fibrocytes, as the cause of nonsyndromic hearing loss. J Hum Genet. 2003;48:564–70.View ArticlePubMedGoogle Scholar
  30. He QY, Liu XH, Li Q, Studholme DJ, Li XW, et al. G8: a novel domain associated with polycystic kidney disease and non-syndromic hearing loss. Bioinformatics. 2006;22:2189–91.View ArticlePubMedGoogle Scholar
  31. Guo J, Cheng H, Zhao S, Yu L. GG: a domain involved in phage LTF apparatus and implicated in human MEB and non-syndromic hearing loss diseases. FEBS Lett. 2006;580:581–4.View ArticlePubMedGoogle Scholar
  32. Michishita E, Garces G, Barrett JC, Horikawa I. Upregulation of the KIAA1199 gene is associated with cellular mortality. Cancer Lett. 2006;239:71–7.View ArticlePubMedGoogle Scholar
  33. Collin RW, Kalay E, Tariq M, Peters T, van der Zwaag B, et al. Mutations of ESRRB encoding estrogen-related receptor beta cause autosomal-recessive nonsyndromic hearing impairment DFNB35. Am J Hum Genet. 2008;82:125–38.PubMed CentralView ArticlePubMedGoogle Scholar
  34. Ben Said M, Ayedi L, Mnejja M, Hakim B, Khalfallah A, et al. A novel missense mutation in the ESRRB gene causes DFNB35 hearing loss in a Tunisian family. Eur J Med Genet. 2011;54:e535–41.View ArticlePubMedGoogle Scholar
  35. Lee K, Khan S, Ansar M, Santos-Cortez RL, Ahmad W, et al. A novel ESRRB deletion is a rare cause of autosomal recessive nonsyndromic hearing impairment among Pakistani families. Genet Res Int. 2011;2011:368915.PubMed CentralPubMedGoogle Scholar
  36. Safka Brozkova D, Lastuvkova J, Machalova E, Lisonova J, Trkova M, et al. DFNB35 due to a novel mutation in the ESRRB gene in a Czech consanguineous family. Int J Pediatr Otorhinolaryngol. 2012;76:1681–4.View ArticlePubMedGoogle Scholar
  37. Lee EK, Han GY, Park HW, Song YJ, Kim CW. Transgelin promotes migration and invasion of cancer stem cells. J Proteom Res. 2010;9:5108–17.View ArticleGoogle Scholar
  38. Welshons WV, Grady LH, Engler KS, Judy BM. Control of proliferation of MCF-7 breast cancer cells in a commercial preparation of charcoal-stripped adult bovine serum. Breast Cancer Res Treat. 1992;23:97–104.View ArticlePubMedGoogle Scholar
  39. Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10:R25.PubMed CentralView ArticlePubMedGoogle Scholar
  40. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 2009;25:1105–11.PubMed CentralView ArticlePubMedGoogle Scholar
  41. Sun L, Fernandez HR, Donohue RC, Li J, Cheng J, et al. Male-specific lethal complex in Drosophila counteracts histone acetylation and does not mediate dosage compensation. Proc Natl Acad Sci USA. 2013;110:E808–17.PubMed CentralView ArticlePubMedGoogle Scholar
  42. Sun L, Johnson AF, Donohue RC, Li J, Cheng J, et al. Dosage compensation and inverse effects in triple X metafemales of Drosophila. Proc Natl Acad Sci USA. 2013;110:7383–8.PubMed CentralView ArticlePubMedGoogle Scholar
  43. Sun L, Johnson AF, Li J, Lambdin AS, Cheng J, et al. Differential effect of aneuploidy on the X chromosome and genes with sex-biased expression in Drosophila. Proc Natl Acad Sci USA. 2013;110:16514–9.PubMed CentralView ArticlePubMedGoogle Scholar
  44. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26:139–40.PubMed CentralView ArticlePubMedGoogle Scholar
  45. Li H, Lovci MT, Kwon YS, Rosenfeld MG, Fu XD, et al. Determination of tag density required for digital transcriptome analysis: application to an androgen-sensitive prostate cancer model. Proc Natl Acad Sci USA. 2008;105:20179–84.PubMed CentralView ArticlePubMedGoogle Scholar
  46. da Huang W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4:44–57.View ArticleGoogle Scholar
  47. da Huang W, Sherman BT, Lempicki RA. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009;37:1–13.PubMed CentralView ArticleGoogle Scholar
  48. Kanehisa M, Goto S, Sato Y, Kawashima M, Furumichi M, et al. Data, information, knowledge and principle: back to metabolism in KEGG. Nucleic Acids Res. 2014;42:D199–205.PubMed CentralView ArticlePubMedGoogle Scholar
  49. Kanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000;28:27–30.PubMed CentralView ArticlePubMedGoogle Scholar

Copyright

© Lu et al. 2015

Advertisement