- Methodology article
- Open Access
Construction of non-polar mutants in Haemophilus influenzae using FLP recombinase technology
- Erin Tracy1Email author,
- Fang Ye1Email author,
- Beth D Baker1Email author and
- Robert S MunsonJr1, 2Email author
https://doi.org/10.1186/1471-2199-9-101
© Tracy et al; licensee BioMed Central Ltd. 2008
- Received: 30 May 2008
- Accepted: 11 November 2008
- Published: 11 November 2008
Abstract
Background
Nontypeable Haemophilus influenzae (NTHi) is a gram-negative bacterium that causes otitis media in children as well as other infections of the upper and lower respiratory tract in children and adults. We are employing genetic strategies to identify and characterize virulence determinants in NTHi. NTHi is naturally competent for transformation and thus construction of most mutants by common methodologies is relatively straightforward. However, new methodology was required in order to construct unmarked non-polar mutations in poorly expressed genes whose products are required for transformation. We have adapted the lambda red/FLP-recombinase-mediated strategy used in E. coli for use in NTHi.
Results
A cassette containing a spectinomycin resistance gene and an rpsL gene flanked by FRT sites was constructed. A PCR amplicon containing 50 base pairs of DNA homologous to the 5' and 3' ends of the gene to be disrupted and the cassette was generated, then recombineered into the target NTHi gene, cloned on a plasmid, using the lambda recombination proteins expressed in E. coli DY380. Thus, the gene of interest was replaced by the cassette. The construct was then transformed into a streptomycin resistant NTHi strain and mutants were selected on spectinomycin-containing growth media. A plasmid derived from pLS88 with a temperature sensitive replicon expressing the FLP recombinase gene under the control of the tet operator/repressor was constructed. This plasmid was electroporated into the NTHi mutant at the permissive temperature and FLP expression was induced using anhydrotetracycline. The recombinase recognizes the FRT sites and eliminates the antibiotic cassette by site-specific recombination, creating the unmarked non-polar mutation. The plasmid is cured by growth of cells at the restrictive temperature.
Conclusion
The products of the genes in the NTHi pilABCD operon are required for type IV pilus biogenesis and have a role in transformation. We demonstrated the utility of our methodology by the construction of a non-polar pilA mutation in NTHi strain 2019 and complementation of the mutation with a plasmid containing the pilA gene. Utilization of this approach allowed us to readily generate unmarked non-polar mutations in NTHi genes.
Keywords
- Spectinomycin
- Kanamycin Resistance Gene
- Chocolate Agar
- Spectinomycin Resistance
- Influenzae Strain
Background
Nontypeable Haemophilus influenzae (NTHi) is a gram-negative bacterium, which is a major cause of otitis media [1, 2]. The organism also causes pneumonia and other respiratory tract diseases in humans [1, 2]. Type IV pili (Tfp) mediate adherence, twitching motility, and play a role in transformation (reviewed by Craig et al [3]). We previously demonstrated that NTHi produce Tfp under defined environmental conditions. These Tfp are responsible for twitching motility, Tfp-mediated adherence and contribute to biofilm development [4–6]. The products of the pilABCD gene cluster play a role in Tfp biogenesis [4, 7, 8]. The pilA gene is predicted to encode the major pilin subunit. The PilB protein is homologous to hexameric secretion ATPases and the PilC protein has homology to inner membrane proteins required for Tfp pilus assembly in other organisms. PilD is predicted to be the prepilin peptidase. These genes are in an operon, which necessitates the construction of non-polar mutants in order to carefully define the role of each gene product.
In NTHi, non-polar mutants have been constructed using the non-polar kanamycin resistance cassette designed by Menard et al [9], see for example Mason et al [10]. This kanamycin resistance gene is promoter-less; thus, transcription is driven from the promoter of the operon. The level of transcription must therefore be at a level sufficient to confer a kanamycin-resistant phenotype to the mutant under normal growth conditions. Alternatively, a non-polar mutant can be constructed in two steps. First, a mutant is constructed using standard methodologies [11] in which a gene has been interrupted with a cassette containing both a selectable and counter-selectable marker. Then, DNA containing an in-frame deletion of the gene of interest together with flanking chromosomal DNA 5' and 3' of the deleted gene is transformed into the mutant. Mutants containing the in-frame deletion are isolated by selection against the counter-selectable marker. Neither of these methodologies is suitable for use with genes whose products are required for transformation since the genes are poorly expressed under normal growth conditions and mutants deficient in the expression of these genes cannot be transformed. We thus adapted the methodologies employed by Wanner and coworkers [12, 13] to construct non-polar mutations in NTHi.
Results and discussion
Construction of a non-polar mutant in the NTHi pilA gene
Mutations have been engineered into the E. coli chromosome using the lambda phage recombinase to catalyze the site-specific insertion of a PCR amplicon containing 50 bp homology arms and a cassette flanked by FRT (FLP r ecombinase t arget) sites, replacing the gene of interest [12, 13]. Given the restriction barriers present in NTHi strains, it was necessary to perform the insertional inactivation of the NTHi genes of interest by cloning the gene together with flanking sequences onto a plasmid, then insertionally inactivating the gene in E. coli before moving the mutation into NTHi using the natural transformation system [11]. E. coli strain DY380 has previously been used for engineering plasmids using the products of the phage lambda recombinase genes [14]. This strain is lysogenized with a defective lambda phage that expresses the recombinase genes under the control of the temperature sensitive λcI 857 repressor and thus is a suitable host for recombineering [15]. In order to construct a pilA mutation in NTHi, the pil gene cluster was first amplified from NTHi strain 2019, then cloned into pGEM-T Easy and transformed into E. coli strain DY380 to form strain DY380(pRSM2855).
Generation of a PCR amplicon for insertion/deletion mutagenesis of the pilA gene. In Panel A, the pilA gene from NTHi strain 2019 is shown. Homology arm 1 (H1) contains 50 base pairs of DNA 5' to and including the ATG start codon of pilA. Homology arm 2 (H2) contains the complement of the last 21 base pairs of the pilA gene and 29 base pairs immediately downstream of the pilA gene. In Panel B, the template region of pRSM2832 is shown. Primer H1P1 contains the sequence from H1 and 20 base pairs of DNA homologous to the 5' end of the cassette (P1). Primer H2P2 contains the sequence from H2 and 20 base pairs of DNA homologous to the 3' end of the cassette. PCR amplification of pRSM2832 with primers H1P1 and H2P2 (primers 5 and 6) yielded the product shown in Panel C.
Construction of a non-polar pilA mutant. The PCR amplicon from Figure 1 is shown in Panel A. The cloned pilABCD region of pRSM2855 is shown in Panel B. The amplicon was electroporated into E. coli DY380(pRSM2855) and the lambda recombinase genes were induced by temperature shock. Spectinomycin-resistant clones were selected. The insert region of plasmid pRSM2857 is shown in Panel C. Plasmid pRSM2857 was linearized and transformed into NTHi strain 2019 rpsL; spectinomycin-resistant clones were isolated. NTHi strain 2019 rpsL ΔpilA::spec-rpsLNg was saved, then transformed with pRSM2947 at the permissive temperature; kanamycin resistant clones were isolated. Expression of the FLP recombinase resulted in the loss of the spectinomycin resistance gene-rpsLNg cassette; growth at 37°C resulted in the loss of the plasmid. The pil region of NTHi strain 2019 rpsL ΔpilA is depicted in Panel D.
NTHi strain 2019 is a well-characterized isolate from a patient with chronic bronchitis [17–19]. The pRSM2857 insert was separated from the plasmid backbone by digestion with NcoI and NsiI, then transformed into a streptomycin-resistant derivative of NTHi strain 2019, designated NTHi strain 2019 rpsL, using the MIV methodology [11]. A strain containing the anticipated insertion/deletion mutation in the pilA gene was saved as NTHi strain 2019 rpsL ΔpilA::spec-rpsLNg. The next step in the construction was the removal of the cassette, which is flanked by FRT sites, by expression of the FLP recombinase.
Map of plasmid pRSM2947. The plasmid contains: the FLP recombinase gene under the control of the tet regulatory system; a temperature sensitive replicon suitable for use in NTHi; a ColE1 origin that is functional in E. coli and a kanamycin resistance marker.
The NTHi strain 2019 rpsL ΔpilA mutant was not transformable; the phenotype was complemented by the pilA gene
Transformation of strain 2019 derivatives
Number of transformants/μg of DNA | |||
---|---|---|---|
Strains | |||
2019 rpsL | 2019 rpsL ΔpilA | 2019 rpsL ΔpilA (pRSM2848) | |
Experiment #1 | 5.4 × 105 | ND | 1.3 × 105 |
Experiment #2 | 4.8 × 105 | ND | 1.7 × 105 |
Strains | |||
2019 | 2019 pilA::ΩKm2 | 2019 pilA::ΩKm2 (pRSM2848) | |
Experiment #3 | 3.9 × 103 | ND | ND |
Experiment #4 | 5.6 × 103 | ND | ND |
Although the putative functions of the pilB, pilC and pilD genes make it likely that the products of these genes are required for transformation, we demonstrated that a polar mutation in the pilA gene could not be complemented with plasmid pRSM2848, the plasmid expressing the pilA gene. A polar pilA mutant, designated 2019 pilA::ΩKm2, was constructed by insertion of the ΩKm2 cassette into the pilA gene as described [4]. As anticipated, this mutant is not transformable and the mutation could not be complemented with the cloned pilA gene (Table 1).
Conclusion
We have developed a new methodology for the construction of mutants in NTHi. This methodology was developed to overcome technical issues related to the construction of non-polar mutants in poorly expressed genes whose products are required for transformation. However, the method is straightforward and robust. We have successfully constructed over 20 mutants using this method and now construct all H. influenzae mutants in our laboratory using this method. The methodology should also be applicable to other naturally transformable members of the Pasteurellaceae family that support the replication of pLS88 derivatives.
Methods
Bacterial strains, plasmids and growth conditions
NTHi strain 2019 is a well characterized strain from a patient with chronic bronchitis [17–19]. NTHi strain 2019 rpsL was constructed by Apicella and coworkers. This strain contains a mutation resulting in a K43R modification in RpsL; the strain is resistant to 1 mg of streptomycin/ml. Both strains were kindly provided by Dr. Michael Apicella. NTHi strains were grown on chocolate agar or in Brain Heart Infusion broth supplemented with 2 μg of NAD/ml and 2 μg of heme/ml (sBHI). Growth media were supplemented with spectinomycin, kanamycin, chloramphenicol or streptomycin at 200 μg/ml, 20 μg/ml, 1 μg/ml or 1 mg/ml, respectively, when appropriate. E. coli strains were grown on LB broth or agar. Growth media were supplemented with spectinomycin, kanamycin, chloramphenicol or ampicillin at 50 μg/ml, 20 μg/ml, 30 μg/ml or 50 ug/ml, respectively, when appropriate. Strain DY380 was grown at 32°C. A complete list of strains and plasmids used in this study is provided [see Additional file 1].
Construction of a template plasmid containing a cassette with a spectinomycin resistance gene and an rpsL gene flanked by FRT sites
Oligonucleotide primers
Primer | Sequence |
---|---|
primer 1 | GCGGATCC CCGACTGATTGTGAGGGATGTCGG |
primer 2 | GCGCGGCCGC CCGACTGATTGTGAGGGATGTCGG |
primer 3 | GCGAGCTC GCATCGCCTTCTATCGCCTTCTTG |
primer 4 | GCCTCGAG CAGCCCTTGCGCCCTGAGTG |
primer 5 | CTTTTCACAATGTTGTCGCTAACAAAGGCTTAATAAAAGGAAAATGAATGATTCCGGGGATCCGTCGACC |
primer 6 | ACGCTGAGTATGAAGTAAAGCATAGCTCGTCATTTTGTGACACTTCTGCATGTAGGCTGGAGCTGCTTCG |
primer 7 | GCGCGTCGACAACCAATAAGGAAATA |
primer 8 | CGAGGCAATGGATCAACAGAAG |
primer 9 | GGGCGTTTATCGAAGTGAGG |
primer 10 | TCAACCCCTAGCCAAAGAC |
primer 11 | CGCGGATCCTGCCGCCTGTTTTTCCTGCTCATT |
primer 12 | CTGTTATCCTTAAATCTCGCTTATTAGGTGTGCTTGTATTTCTTGGG |
primer 13 | CCCAAGAAATACAAGCACACCTAATAAGCGAGATTTAAGGATAACAG |
primer 14 | CGCGGATCC GCGGCCGCGTGACACGACGATGCTAAA |
primer 15 | ATATAATGCGGCCGC TACGGTTATCCACAGAATCA |
primer 16 | ATATAATGCGGCCGC CTCACTGATTAAGCATTGG |
primer 17 | CGCGGATCC CGATGGGTGGTTAACTCGAC |
primer 18 | CGCGGATCC ACAGGACGGGTG |
primer 19 | GCACGCGT TCGTCAAATATTACGGATATTAA |
primer 20 | GCACGCGT TCATTGTGTGACACTTCCG |
Amplification of the cassette
Since lambda recombinase requires less than 50 bp of homology for efficient recombination, PCR primers of approximately 70 nt in length were designed using the strategy of Baba et al [12]. The 5' PCR primer (primer 5) had a 50 nt homology arm (H1) including the sequence upstream of pilA as well as the pilA start codon and the 20 nt sequence 5'-ATTCCGGGGATCCGTCGACC-3' (P1) which is complementary to sequence 5' of the spectinomycin resistance gene-rpsL cassette (Figure 1). The 3' primer (primer 6) contained the complement of the last 21 nt of the pilA gene including the termination codon and 29 nt downstream (H2) as well as the 20 nt sequence 5'-TGTAGGCTGGAGCTGCTTCG-3' (P2) which is complementary to sequence 3' of the spectinomycin resistance gene-rpsLNg cassette. A PCR amplicon was generated using these primers together with pRSM2832 as the template. Amplification was performed in a 50 μl reaction containing 1 U Phusion High Fidelity DNA Polymerase (New England Biolabs), 25 ng pRSM2832 DNA, 0.4 μM of each primer, and 200 μM dNTPs under the following conditions: 98°C for 30 seconds, 30 cycles of 98°C for 10 seconds, 51°C for 20 seconds, 72°C for 3 minutes, and a final extension of 72°C for 10 minutes. The amplicon thus contains the spectinomycin resistance gene-rpsL cassette flanked by the homology arms H1 and H2.
Construction of a pilA mutant in NTHi strain 2019 rpsL containing the spectinomycin resistance gene-rpsLNg cassette
The pilABCD gene cluster of NTHi strain 2019 as well as 227 bp 5' of the pilA gene was amplified by PCR from genomic DNA purified from NTHi strain 2019 using primers 7 and 8 and cloned into pGEM-T Easy (Promega) (Figure 2B). The nucleotide sequence of the NTHi strain 2019 pilABCD gene cluster is 94% identical to the gene cluster in strain 86-028NP (Genbank Accession # CP000057). Plasmid DNA was purified, verified by restriction digestion, and sequenced. A clone with the correct sequence was identified and saved as pRSM2855. Plasmid pRSM2855 was transformed into the E. coli strain DY380 at 32°C and clones were selected on LB agar containing ampicillin. Strain DY380 contains a defective lambda prophage with a temperature sensitive repressor [14]. In this strain, the lambda recombinase genes are actively transcribed after temperature shock at 42°C.
To construct a plasmid containing a marked deletion of the pilA gene, 200 ng of PCR product containing the spectinomycin resistance gene-rpsLNg cassette was electroporated into E. coli DY380(pRSM2855) that had been heat shocked at 42°C for 15 minutes prior to preparation of electrocompetent cells as described by Lee et al [14]. Clones were then selected at 32°C on LB agar containing spectinomycin. A plasmid containing a deletion of the pilA gene with an insertion of the cassette was identified and saved as pRSM2857 (Figure 2C).
Plasmid pRSM2857 was digested with NcoI and NsiI to release the insert from the pGEM-T Easy vector backbone, then transformed into NTHi strain 2019 rpsL using the MIV methodology [11]. Clones were selected on chocolate agar supplemented with spectinomycin. Putative mutants were screened for streptomycin sensitivity on chocolate agar containing streptomycin. The genotype of presumptive mutants was further characterized by PCR amplification of the genomic region using primers 9 and 10, followed by sequencing.
Construction of the FLP Recombinase containing plasmid, pRSM2947
Deletion of the cassette to generate the non-polar mutation in NTHi strain 2019 rpsL requires the activity of the FLP recombinase. We constructed a temperature sensitive plasmid containing the FLP recombinase gene under the control of the tet promoter/repressor system. Briggs and Tatum previously reported the construction of a plasmid with a temperature sensitive replicon suitable for use in members of the Pasteurellaceae family [22]. This plasmid has the same replicon as the plasmid pLS88 [23]. A point mutation of G to A at base 2196 of pLS88 was introduced into a fragment of pLS88 containing the replicon and kanamycin resistance gene using overlap PCR. Briefly, amplicons 1 and 2 corresponding to NT 1715 to 2220 and 2174 to 4093 of pLS88 were generated with primers 11 and 12 or primers 13 and 14, respectively, using pLS88 DNA as template. Amplicon 3 was generated with primers 11 and 14, which both contain BamHI sites, using amplicons 1 and 2 as template. The amplicon was digested with BamHI, and self-ligated. The ligation mixture was transformed into H. influenzae strain Rd by electroporation. Plasmid-containing strains were selected by growth at 32°C on chocolate agar containing kanamycin. Strains containing the correct plasmid were identified by screening for growth at 32°C, but absence of growth at 37°C on chocolate agar containing kanamycin. A temperature sensitive plasmid was saved as pRSM2865. This intermediate plasmid is 2.3 Kb in size and contains unique NotI and BamHI sites. The presence of the mutation in pRSM2865 was confirmed by DNA sequencing. Although pLS88 is stably maintained in E. coli, pRSM2865 could not be maintained in E. coli, even when grown at 32°C. Thus, for convenience, a fragment of pUC19 containing the ColE1 replicon was amplified with primers 15 and 16; both primers contain a NotI site. The resulting amplicon was digested with Not I, then cloned into NotI-digested pRSM2865. After transformation into E. coli strain DH5α, a plasmid with the correct restriction map was saved as pRSM2866. Using pFT-A [24] as template and primers 17 and 18, which contain BamHI sites, an amplicon was generated which contained the FLP recombinase gene under control of the tet promoter/repressor system flanked by BamHI sites. The amplicon was digested with BamHI and the product ligated to BamHI-digested pRSM2866. The ligation mixture was transformed into DH5α and clones selected on LB agar containing kanamycin. A plasmid with the correct restriction map was identified and saved as pRSM2947 (Figure 3).
Construction of pilA mutants in NTHi strain 2019 background
In order to construct an in-frame, non-polar deletion of the cloned pilA gene in NTHi strain 2019 rpsL, plasmid pRSM2947 was transformed by electroporation into NTHi strain 2019 rpsL ΔpilA::spec-rpsLNg and transformants were selected at 32°C on chocolate agar containing kanamycin. Clones were grown at 32°C in sBHI broth supplemented with kanamycin until a final absorbance (600 nm) of 0.30 was reached. The FLP recombinase was then induced with 200 ng of anhydrotetracycline/ml for 2 hours, shaking (180 rpm) at 32°C. Unmarked mutants were then selected by growth at 37°C on chocolate agar supplemented with streptomycin. Mutants were then screened for loss of both spectinomycin and kanamycin resistance genes and the genotype was verified by PCR and sequencing (Figure 2D). Although convenient, the streptomycin counterselection is not necessary. After induction of the FLP recombinase using our methodology, the cassette is resolved in approximately 2% of the clones; thus, it is possible to identify mutants by screening. A detailed protocol for mutant construction in NTHi strains is provided [see Additional file 2].
A polar mutation in the pilA gene of strain 2019 was constructed as described [4]. The mutant is designated 2019 pilA::ΩKm2.
Complementation of the pilA mutation in NTHi strains 2019 rpsL ΔpilA and 2019 pilA::ΩKm2
The plasmid pPIL1 containing the NTHi pilABCD gene cluster [4] was PCR amplified with primers 19 and 20, which face outward from the 3' end of pilA and the 3'end of pilD. The primers both contain MluI sites on their 5' ends. The amplicon was digested with MluI, self-ligated, and transformed into H. influenzae strain Rd. The resulting plasmid contained the pSPEC1 backbone, the pilA gene, and a small ORF containing the 5' portion of the pilB gene cloned in-frame with the 3' end of the pilD gene. A clone with the correct restriction map was sequenced, then saved as pRSM2848. The plasmid pRSM2848 was then transformed into NTHi strains 2019 rpsL ΔpilA and 2019 pilA::ΩKm2.
Cloning and insertional inactivation of the cya gene
We cloned and insertionally inactivated the cya gene. This interrupted gene was used to test the strains for their ability to be transformed. The cya gene from H. influenzae strain Rd and approximately 1 Kb of flanking DNA 5' and 3' to the gene were amplified and cloned into pGEM-T Easy essentially as described for construction of pRSM2855. A clone with the correct restriction map was saved as pRSM2921. The non-polar kanamycin cassette [9] was cloned into KpnI- and BamHI-digested pRSM2921 as a KpnI to BamHI fragment. After ligation and transformation, a plasmid containing the insertionally inactivated cya gene was identified and saved as pRSM2948. The cloned cya gene was also insertionally inactivated by cloning a BamHI fragment containing the chloramphenicol cassette from pUCΔEcat into BglII-digested pRSM2921. As plasmid containing the insertionally inactivated cya gene was saved as pRSM3004.
Determination of transformation efficiency
Transformation efficiency was determined in strains 2019 rpsL, 2019 rpsL ΔpilA and 2019 rpsL ΔpilA(pRSM2848). DNA from NotI-digested pRSM2948 was incubated with cells treated to induce competence using the modified MIV methodology; transformants were identified on chocolate agar plates containing kanamycin. Similarly, transformation efficiency was determined in strains 2019 pilA::ΩKm2 and 2019 pilA::ΩKm2(pRSM2848) using linearized pRSM3004 as above, except that transformants were selected on chloamphenicol-containing medium.
Declarations
Acknowledgements
This work was supported by NIH grants R01DC007464 to RSM, R01DC003915 to Lauren Bakaletz and a subcontract from N01AI30040 to Michael Apicella. We thank Michael Apicella for the gifts of NTHi strains 2019 and 2019 rpsL.
Authors’ Affiliations
References
- Kilpi T, Herva E, Kaijalainen T, Syrjanen R, Takala AK: Bacteriology of acute otitis media in a cohort of Finnish children followed for the first two years of life. Pediatr Infect Dis J 2001, 20(7):654-662. 10.1097/00006454-200107000-00004View ArticlePubMedGoogle Scholar
- Murphy TF: Respiratory infections caused by non-typeable Haemophilus influenzae . Curr Opin Infect Dis 2003, 16(2):129-134.View ArticlePubMedGoogle Scholar
- Craig L, Pique ME, Tainer JA: Type IV pilus structure and bacterial pathogenicity. Nat Rev Microbiol 2004, 2(5):363-378. 10.1038/nrmicro885View ArticlePubMedGoogle Scholar
- Bakaletz LO, Baker BD, Jurcisek JA, Harrison A, Novotny LA, Bookwalter JE, Mungur R, Munson RS Jr: Demonstration of Type IV pilus expression and a twitching phenotype by Haemophilus influenzae . Infect Immun 2005, 73(3):1635-1643. 10.1128/IAI.73.3.1635-1643.2005PubMed CentralView ArticlePubMedGoogle Scholar
- Jurcisek JA, Bakaletz LO: Biofilms formed by nontypeable Haemophilus influenzae in vivo contain both double-stranded DNA and type IV pilin protein. J Bacteriol 2007, 189(10):3868-3875. 10.1128/JB.01935-06PubMed CentralView ArticlePubMedGoogle Scholar
- Jurcisek JA, Bookwalter JE, Baker BD, Fernandez S, Novotny LA, Munson RS Jr, Bakaletz LO: The PilA protein of non-typeable Haemophilus influenzae plays a role in biofilm formation, adherence to epithelial cells and colonization of the mammalian upper respiratory tract. Mol Microbiol 2007, 65(5):1288-1299. 10.1111/j.1365-2958.2007.05864.xView ArticlePubMedGoogle Scholar
- Redfield RJ, Cameron AD, Qian Q, Hinds J, Ali TR, Kroll JS, Langford PR: A novel CRP-dependent regulon controls expression of competence genes in Haemophilus influenzae . J Mol Biol 2005, 347(4):735-747. 10.1016/j.jmb.2005.01.012View ArticlePubMedGoogle Scholar
- VanWagoner TM, Whitby PW, Morton DJ, Seale TW, Stull TL: Characterization of three new competence-regulated operons in Haemophilus influenzae . J Bacteriol 2004, 186(19):6409-6421. 10.1128/JB.186.19.6409-6421.2004PubMed CentralView ArticlePubMedGoogle Scholar
- Menard R, Sansonetti PJ, Parsot C: Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. J Bacteriol 1993, 175(18):5899-5906.PubMed CentralPubMedGoogle Scholar
- Mason KM, Munson RS Jr, Bakaletz LO: A mutation in the sap operon attenuates survival of nontypeable Haemophilus influenzae in a chinchilla model of otitis media. Infect Immun 2005, 73(1):599-608. 10.1128/IAI.73.1.599-608.2005PubMed CentralView ArticlePubMedGoogle Scholar
- Poje G, Redfield RJ: Transformation of Haemophilus influenzae . Methods Mol Med 2003, 71: 57-70.PubMedGoogle Scholar
- Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H: Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2006, 2: 2006.0008. 10.1038/msb4100050PubMed CentralView ArticlePubMedGoogle Scholar
- Datsenko KA, Wanner BL: One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 2000, 97(12):6640-6645. 10.1073/pnas.120163297PubMed CentralView ArticlePubMedGoogle Scholar
- Lee EC, Yu D, Martinez de Velasco J, Tessarollo L, Swing DA, Court DL, Jenkins NA, Copeland NG: A highly efficient Escherichia coli -based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 2001, 73(1):56-65. 10.1006/geno.2000.6451View ArticlePubMedGoogle Scholar
- Copeland NG, Jenkins NA, Court DL: Recombineering: a powerful new tool for mouse functional genomics. Nat Rev Genet 2001, 2(10):769-779. 10.1038/35093556View ArticlePubMedGoogle Scholar
- Johnston DM, Cannon JG: Construction of mutant strains of Neisseria gonorrhoeae lacking new antibiotic resistance markers using a two gene cassette with positive and negative selection. Gene 1999, 236(1):179-184. 10.1016/S0378-1119(99)00238-3View ArticlePubMedGoogle Scholar
- Campagnari AA, Gupta MR, Dudas KC, Murphy TF, Apicella MA: Antigenic diversity of lipooligosaccharides of nontypable Haemophilus influenzae . Infect Immun 1987, 55(4):882-887.PubMed CentralPubMedGoogle Scholar
- Johnston JW, Zaleski A, Allen S, Mootz JM, Armbruster D, Gibson BW, Apicella MA, Munson RS Jr: Regulation of sialic acid transport and catabolism in Haemophilus influenzae . Mol Microbiol 2007, 66(1):26-39. 10.1111/j.1365-2958.2007.05890.xView ArticlePubMedGoogle Scholar
- Jurcisek J, Greiner L, Watanabe H, Zaleski A, Apicella MA, Bakaletz LO: Role of sialic acid and complex carbohydrate biosynthesis in biofilm formation by nontypeable Haemophilus influenzae in the chinchilla middle ear. Infect Immun 2005, 73(6):3210-3218. 10.1128/IAI.73.6.3210-3218.2005PubMed CentralView ArticlePubMedGoogle Scholar
- Whitby PW, Morton DJ, Stull TL: Construction of antibiotic resistance cassettes with multiple paired restriction sites for insertional mutagenesis of Haemophilus influenzae . FEMS Microbiol Lett 1998, 158(1):57-60. 10.1111/j.1574-6968.1998.tb12800.xView ArticlePubMedGoogle Scholar
- Wang RF, Kushner SR: Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli . Gene 1991, 100: 195-199. 10.1016/0378-1119(91)90366-JView ArticlePubMedGoogle Scholar
- Briggs RE, Tatum FM: Generation and molecular characterization of new temperature-sensitive plasmids intended for genetic engineering of Pasteurellaceae . Appl Environ Microbiol 2005, 71(11):7187-7195. 10.1128/AEM.71.11.7187-7195.2005PubMed CentralView ArticlePubMedGoogle Scholar
- Dixon LG, Albritton WL, Willson PJ: An analysis of the complete nucleotide sequence of the Haemophilus ducreyi broad-host-range plasmid pLS88. Plasmid 1994, 32(2):228-232. 10.1006/plas.1994.1060View ArticlePubMedGoogle Scholar
- Posfai G, Koob MD, Kirkpatrick HA, Blattner FR: Versatile insertion plasmids for targeted genome manipulations in bacteria: isolation, deletion, and rescue of the pathogenicity island LEE of the Escherichia coli O157:H7 genome. J Bacteriol 1997, 179(13):4426-4428.PubMed CentralPubMedGoogle Scholar
- Hansen EJ, Latimer JL, Thomas SE, Helminen M, Albritton WL, Radolf JD: Use of electroporation to construct isogenic mutants of Haemophilus ducreyi . J Bacteriol 1992, 174(16):5442-5449.PubMed CentralPubMedGoogle Scholar
- Perez-Casal J, Caparon MG, Scott JR: Mry, a trans-acting positive regulator of the M protein gene of Streptococcus pyogenes with similarity to the receptor proteins of two-component regulatory systems. J Bacteriol 1991, 173(8):2617-2624.PubMed CentralPubMedGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.