Skip to main content

Advertisement

Table 2 Oligonucleotide primers

From: Construction of non-polar mutants in Haemophilus influenzae using FLP recombinase technology

Primer Sequence
primer 1 GCGGATCC CCGACTGATTGTGAGGGATGTCGG
primer 2 GCGCGGCCGC CCGACTGATTGTGAGGGATGTCGG
primer 3 GCGAGCTC GCATCGCCTTCTATCGCCTTCTTG
primer 4 GCCTCGAG CAGCCCTTGCGCCCTGAGTG
primer 5 CTTTTCACAATGTTGTCGCTAACAAAGGCTTAATAAAAGGAAAATGAATGATTCCGGGGATCCGTCGACC
primer 6 ACGCTGAGTATGAAGTAAAGCATAGCTCGTCATTTTGTGACACTTCTGCATGTAGGCTGGAGCTGCTTCG
primer 7 GCGCGTCGACAACCAATAAGGAAATA
primer 8 CGAGGCAATGGATCAACAGAAG
primer 9 GGGCGTTTATCGAAGTGAGG
primer 10 TCAACCCCTAGCCAAAGAC
primer 11 CGCGGATCCTGCCGCCTGTTTTTCCTGCTCATT
primer 12 CTGTTATCCTTAAATCTCGCTTATTAGGTGTGCTTGTATTTCTTGGG
primer 13 CCCAAGAAATACAAGCACACCTAATAAGCGAGATTTAAGGATAACAG
primer 14 CGCGGATCC GCGGCCGCGTGACACGACGATGCTAAA
primer 15 ATATAATGCGGCCGC TACGGTTATCCACAGAATCA
primer 16 ATATAATGCGGCCGC CTCACTGATTAAGCATTGG
primer 17 CGCGGATCC CGATGGGTGGTTAACTCGAC
primer 18 CGCGGATCC ACAGGACGGGTG
primer 19 GCACGCGT TCGTCAAATATTACGGATATTAA
primer 20 GCACGCGT TCATTGTGTGACACTTCCG
  1. Restriction endonuclease cleavage sites are shown in bold.