Skip to main content


Prediction and preliminary validation of oncogene regulation by miRNAs

Article metrics



MicroRNAs (miRNAs) are one of the most abundant groups of regulatory genes in multicellular organisms, playing important roles in many fundamental cellular processes. More than four hundred miRNAs have been identified in humans and the deregulation of miRNA expression has been also shown in many cancers. Despite the postulated involvement of miRNAs in tumourigenesis, there are only a few examples where an oncogene or a tumour suppressor has been identified as a miRNA target.


Here, we present an in silico analysis of potential miRNA- oncogene interactions. Moreover, we have tested the validity of two possible interactions of miRNAs with genes related to cancer. We present evidence for the down-regulation of c-MYC, one of the most potent and frequently deregulated oncogenes, by let-7 miRNA, via the predicted binding site in the 3'UTR, and verify the suppression of BCL-2 by miR16.


In this work both bioinformatic and experimental approaches for the prediction and validation of possible targets for miRNAs have been used. A list of putative targets for different oncomirs, validation of which would be of special interest, is proposed and two such interactions have been experimentally validated.


Originally discovered as a rare example of single-stranded ~22-nt RNA regulators of developmental timing in C. elegans, microRNAs are now regarded as playing an important regulatory role in gene expression of animals and plants [15]. Even more, it has turned out that miRNAs are one of the most abundant groups of regulatory genes in multicellular organisms [6]. These small RNAs negatively regulate gene expression at the post-transcriptional level involving duplex formation between the miRNA and the messenger RNA. It is believed that the level of complementarity between these two molecules is decisive of the type of regulation achieved by the miRNAs. When the binding is supported by extensive or complete complementarity to the coding region of the mRNA, the RNAi pathway is induced, resulting in the cleavage and degradation of the target transcript. This type of regulation, involving RNA-induced silencing complex (miRISC) and miRNA-directed mRNA cleavage, is widely observed in plants [5, 79] but has been also reported to occur in mammals [10]. In animals, however, miRNA-mRNA binding is more variable, it may contain several mismatches, loops and bulges, and it is found to take place mainly in the 3'UTR of the messenger molecule [1116]. This imperfect complementarity leads to another type of gene regulation which does not include mRNA cleavage but apparently inhibition of translation [17, 18]. In this case the protein levels are reduced, but the mRNA abundance in the cell remains unchanged. Besides these two types of regulation, recent studies have indicated that there is at least an additional way in which miRNAs can negatively influence gene expression. By the same incomplete pairing with the 3'UTR, miRNAs are able to destabilize and reduce mRNA concentration, by accelerating poly (A) tail removal leading to miRNA-mediated mRNA decay [19, 20]. This type of mechanism is irreversible, like the mRNA cleavage, and seems to be an important part of the miRNA-regulatory network. Another significant feature of the microRNA binding is the crucial pairing of the miRNA 5'end nucleotides [2125]. Brennecke et al. [26] have suggested the general structural requirements for the functionality of miRNA sites with the incomplete complementarity.

Since the discovery of miRNAs, their number and the examples of their possible functions have dramatically grown. It has been shown that the expression levels of particular miRNAs differ depending on the developmental stage, cell type and tissue [2729]. Altered expression pattern (over- or under-expression) of specific miRNAs has been also reported in tissues derived from various tumours [3, 3033]. A very large portion (more than 50%) of the human miRNAs are located in so-called "fragile sites", on chromosomes which are frequently deleted, amplified or rearranged in case of cancer development [34]. This data together suggest that the aberrant activity of miRNAs, influencing basic cellular processes such as growth, proliferation and differentiation of cells, may contribute to tumourigenesis. The possible functions of cancer-related microRNAs, termed recently "oncomirs" [31, 35], have been therefore widely investigated (reviewed in [3538]). It was found that miR-15a and miR-16 were deleted or downregulated in lymphocytic leukaemia [39]; let-7 was downregulated in lung cancers [40, 41]; the miR-17 cluster was amplified in several types of lymphoma and solid tumours [31, 42, 43]; miR-21 was overexpressed in glioblastoma [44, 45] and breast cancer [46]; levels of miR-143 and miR-145 were decreased in colorectal neoplasia, breast, prostate and cervical cancers [46, 47]; miR155 was upregulated in Burkitt and B-cell lymphomas [4850] and also in breast cancer [46]. Although deregulation of expression of many miRNAs has been already reported in different cancers, the direct interaction between the particular miRNA and mRNA of a specific oncogene has been proved only in a few cases. More specifically, experimentally has been shown, the suppression of RAS oncogene by let-7 [40]; the suppression of BCL-2 by miR-15a and miR-1 [51]; the regulation of transcription factor E2F1 activity by miR-17-5p and miR-20 [52]; the downregulation of the KIT oncogene by miR-221 and miR-222 [53], the inhibition of the expression of tumour-supressor LATS2 and the influence on p53 pathway by miR-372 and miR-373 [54], and finally, the downregulation of the proto-oncogene BCL6 by miR-127 [55].

In this work, we present both computational and experimental approaches for verification of human miRNA target sites. Using bioinformatics methods, we have found a large number of potential target sites for miRNAs in the group of oncogenes and genes related to cancer. Further, by an experimental approach, we have tested the validity of two possible interactions. We present here evidence that let-7 binds to the 3'UTR of c-MYC oncogene and downregulates its expression. Moreover, we have confirmed that miR-16 regulates BCL-2, (previously reported by others [51]), and we have proposed the other putative targets for different oncomirs, validation of which would be of special interest.


In silico analysis

The goal of the bioinformatic analysis was to find potential binding sites for cloned miRNAs in the set of human oncogenes. In humans, as in other animals, the miRNA regulation is accomplished by binding the microRNAs predominantly to the 3' untranslated region (UTR) of the messenger RNA. [21, 56, 57]. For this reason the investigation and scanning for miRNA:mRNA binding sites was limited to 3'UTR sequences of Homo sapiens.

After the scanning and filtering of the UTRs oncogenes dataset (149 sequences), positive results for 294 binding sites in 80 sequences (genes) from this set were obtained. Table 1 presents an arbitrary selection of known oncogenes with their predicted miR-regulators as examples of the analysis. The whole list is placed as supplementary material (Additional file 1). Most of the oncogenes presented contain multiple predicted binding sites in their UTRs, which is in accordance with the current understanding that a gene is usually regulated by more than one miRNA, or else contains multiple sites of one miRNA for a combinatorial or more efficient regulation [18, 58, 59].

Table 1 Examples of predicted miRNA/oncogene interactions

From the unfiltered results obtained automatically by the programme, we chose the group of records showing relatively weak 3' pairing but very strong and extensive 5' pairing (seed site), which is characteristic of strong and potentially positive targets [59].

Of the interactions predicted, we thought that the potential interaction between the oncogene c-MYC and the let-7c miRNA could be of particular interest due to the known importance of the gene and the conservation of the specific miRNA. The secondary structure of this pair shows good complementarity in the 5' of the let-7c miRNA (9 nt) which is considered very important for the target recognition [56]. In addition, good pairing in the 3' region was found in silico (Fig. 1A). The duplex structure seems to have all the properties for an animal miRNA binding that are needed for down-regulation of a gene. The binding of let-7c miRNA is in position 114 of the 3'UTR. Furthermore, independently of the first analysis, we inspected in detail miRNAs binding sites of human and murine forms of the MYC gene. In each tested MYC mRNA we could detect and identify in the 3' UTR a binding site for a representative of the human/murine let-7 member of miRNAs (Additional file 2).

Figure 1

Schematic representation of the predicted interaction between miRNA and the mRNA target 3'UTR site. Figures (A) and (C) show wild-type interactions for c-MYC/7c and BCL-2/16, respectively. In figures (B) and (D) the predicted interaction between miRNA and the respective mutated binding site is depicted (B for c-MYC, D for BCL-2 ). (E) microRNA 195 from the miR-15 family was predicted to be a reliable regulator for BCL-2 gene (see text for more details).

Sethupathy et al. [60] analysed human/murine experimentally validated examples and showed that there is a tendency for the binding sites to occur closer to the start of the UTR than to the end. We have also checked all the human/murine MYC potential interactions with let-7 and found that they are all located in the 2/3-th region of the 3'UTR. However, there is no obligatory region that has been proven so far for the localization of the miRNA binding sites within the 3' UTR. miRNA sites also have preferences to the of 3'UTRs sequence composition. According to Robins et al., the large majority (~75%) of human miRNA target genes have AT-rich 3'UTRs [61]. We have tested our human/murine genes, and the great majority have high AT content (between 51% and 70%, with an average of 61%).

Our in silico analysis revealed also an additional interaction of potential interest (Fig. 1C). It has been previously reported that miR-15a and miR-16-1 target BCL2 mRNA [51]. We have found that also another member of the miRNA 15 family is predicted to bind exactly on the same site as miR-16 (pos. 2500 in the BCL2 3'UTR). This miRNA, miR-195, shares the same seed region with miR-15 and miR-16 and shows high similarity to the rest of the miR-15 family sequence. The free energy of the miR-195/BCL2 (26.5 kcal/mol) is even stronger than for miR-16/BCL2 (23.3 kcal/mol). The secondary structure is the same perfectly symmetrical 5'dominant site, with an even smaller central loop (Fig. 1E). The microarray analysis revealed that miR-195 is an immuno-specific miRNA, and is expressed at a high level in all organs of the immune system [62]. This miRNA is abundant in lymphocytes and is encoded in a region of chromosome 17 which is missing in some forms of CLL [6365].

Experimental validation

We concentrated on target genes forming almost perfect duplexes with their miRNA partners in the 5' "seed" region, with a central loop and having an arbitrary free energy around -23 kcal/mol, which is a typical energy value for formation of this sort of structures. Therefore, two very important oncogenes BCL-2 and c-MYC were chosen from the list for further investigation, and their potential micro-regulators miR-16 and let-7c, respectively.

For the experimental verification of the predicted interactions between selected miRNAs and their putative targets, experiments using sensor constructs carrying a Renilla luciferase reporter were performed. miRNAs' activity on reporter genes bearing the miRNA-binding sites have been previously demonstrated [22, 23, 66]. Only sequences carrying binding sites for appropriate miRNAs were used. Since it is known that most of the mammalian targets often contain binding sites for multiple miRNA [23], constructs carrying a single binding site for the tested miRNA and constructs carrying binding sites repeated three times were used (Fig. 2). Moreover, constructs having mutations disrupting the native pairing within the binding region (5' seed site) of the candidate miRNAs (designated as MUT) and constructs showing perfect complementarity (PM) to them were generated as well, in order to provide a negative and a positive control, respectively. All types of cassettes prepared were placed into the phRL-TK-Bst EII vector, downstream of the hRluc gene at Bst EII sites.

Figure 2

Constructs used for the validation of miRNA- oncogene interaction. The sequence of the Bst EII cassette is shown on the top. Predicted binding sites for appropriate miRNAs were inserted into Bst EII site. Single target sites or triplets were used for c-MYC and BCL-2 genes (for sequences see the Additional file 4).

We performed the transfection of HeLa cells for sensors of BCL-2 and c-MYC miRNA potential binding sites. Each time, four constructs were tested in parallel: an empty luciferase vector (Control), wt potential binding site for appropriate miRNA (WT_b.s), mutated binding site (MUT_b.s) and site with full complementarity (PM_b.s). Since the miRNAs of interest have been shown to be expressed in HeLa cells at relatively high levels [62] there was no need for miRNA precursor over-expression. Luciferase activity was measured and normalised against the β-galactosidase expression.

Although at the time we were conducting our experiments the regulation of BCL-2 by miR-16 was reported [51], we nevertheless decided to include this interaction in the study, as an additional control of the approach we used for miRNA target verification. In our system, using only the expected miR-16 binding site of BCL-2 3'UTR, we confirmed that BCL-2 oncogene is targeted by miR-16. More specifically, we obtained 1.78 fold reduction of the luciferase activity even when the sensor construct carried a single binding site for miR-16. The activity was decreased up to 56% compared to 100% in the control (Fig. 3A). The suppression was stronger when a construct that contained a triple miR-16 binding site was used and resulted in 2.18 fold downregulation – only 45.8% of the original luciferase activity measured (Fig. 3B). The HeLa transfections were repeated 6 and 10 times, respectively, and the score is presented as an average.

Figure 3

Relative repression of luciferase expression standardised to a transfection control. The following reporter constructs were tested: (A) BCL-2 reporter constructs carrying a single binding site for miR-16, (B) BCL-2 reporter construct carrying a triple binding site for miR-16, (C) c-MYC reporter constructs carrying a single binding site for let-7, (D) c-MYC reporter constructs including sensors carrying the whole 3'UTRs from the c-MYC gene. The luciferase activity was normalised against β-gal expression. Results are presented in % (100% – luciferase vector with no binding site, (+) control). Average from several experiments is shown (details in the text).

The sensor construct carrying the c-MYC potential single binding site for let-7c appeared to be consistently well down-regulated by let-7 microRNA. The luciferase activity dropped to 72% of the empty vector (about 1.41 fold reduction). Since a single mutation at position 3 of the "seed" in the c-MYC MUT_b.s -sensor (our negative control) – was not sufficient for full reversion of the luciferase activity compared to WT_b.s, we decided to test also c-MYC doubleMUT_b.s, a construct bearing two mutations in the 5' "seed" element, one at position 3 and one at position 5 (Fig. 1B). The transfection experiments confirmed that the down-regulation of c-MYC oncogene is highly reproducible. As expected, the luciferase activity for c-MYC doubleMUT_b.s showed a more efficient de-repression, becoming almost equal to the control experiment (98.1%). Conversely, the activity of luciferase measured for the c-MYC PM_b.s construct was very low (17.3%). The data represent the average score from 10 independent experiments (Fig. 3C).

To confirm further that cMYC oncogene is a real target for let-7c we performed next transfections of HeLa cells, using anti-let-7c inhibitor in order to block the predicted interaction of let-7c with our sensor constructs. The co-transfection of anti let-7 resulted in derepression of the luciferase activity in sensor constructs (the exception was the construct bearing PM b.s for c-MYC), although derepression was not equally efficient for all sensor constructs (Additional file 3).

It is worth noting, that all perfect matching constructs used as positive controls interacting with the miRNA under investigation through the siRNA pathway [10, 67, 68] worked consistently well. The luciferase activity in all studied cases was always repressed at a very low level, ranging from 5% up to 30% of the empty reporter construct.

Further we intended to investigate whether the effect of let-7 on the c-MYC binding site-containing reporter could be recapitulated when the whole 3'UTR of c-MYC was present downstream of the luciferase gene. This is important since it is possible that structural features of the UTR may hinder the miRNA/target interaction. For this purpose, the whole c-MYC 3'UTR was cloned into the luciferase vector. In addition, two point mutations in the seed region of the potential let-7c b.s in the c-MYC 3'UTR were introduced, similarly to the c-MYC doubleMUT_b.s sensor construct carrying only the let-7c b.s (compare to Fig. 1B). Again, a series of HeLa transfections was performed. Five constructs were tested in parallel: an empty luciferase vector (negative control), the construct carrying the potential b.s for let-7c (WT_b.s), the construct with the whole cMYC 3'UTR (WT_3'UTR), the construct with the mutated c-MYC 3'UTR (MUT_3'UTR) and the construct carrying b.s with full complementarity (PM_b.s – our positive control). Both c-MYC constructs, the one carrying the potential let-7c binding site only and the construct carrying the whole 3'UTR of c-MYC, showed a suppression of the luciferase activity compared to the control vector, although not at equal levels to each other. The construct with the single let-7 b.s reduced the luciferase activity to 66.8 % of the control, while for the construct with the whole 3'UTR the reduction was on average up to 45.6 %. In the case of the c-MYC MUT_3'UTR sensor the luciferase activity reached 51.2 % of the control, suggesting that the mutation disturbing the potential b.s for let-7c restored the activity of luciferase when compared to the WT_3'UTR sensor, however, not efficiently compared with the construct bearing the let-7 binding site only (WT_b.s). The HeLa transfections and luciferase assays were repeated 6 times and the score is presented as an average (Fig. 3D).

Finally, we determined the extent to which endogenously-expressed c-MYC is subjected to the regulation by let-7 microRNA. We have monitored c-MYC expression at the mRNA and protein levels following the inhibition of let-7 with the antisense synthetic let-7 oligo (anti-let-7c from Dharmacon) in HeLa cells. 48 h post-transfection RNAs and proteins were extracted from HeLa cells and analysed by Northern and Western methods, respectively. We detected a mild increase at the mRNA level and quite a significant increase at the protein level (Fig. 4A and 4B). In addition to the increase of c-MYC protein level, we also observed accelerated growth rate of the transfected HeLa cells, eventually causing early cells' death (not shown). On the contrary to the specific effect caused by the introduction of anti-let-7c, we did not observe similar changes, either at mRNA or protein levels, when an irrelevant anti-miR was used (synthetic antisense miR-195 oligo).

Figure 4

Inhibition of let-7c enhances cMYC mRNA and protein levels. Northern blot (A) and Western blot (B) and analyses were performed 48 hours after transfection of HeLa cells with anti-let-7c inhibitor. RNAs and protein samples were extracted from non-transfected HeLa cells and cells transfected with the anti-let-7c and anti-miR-195 oligos, as indicated in figures. In case of the western analysis a positive control (protein extract from lymphoma cells overexpressing cMYC) was included as well.


More than 400 human miRNAs have been identified so far [69] and bioinformatics analyses predict that the total number may be around 1000 [6, 70]. More than 200 miRNAs have been already correlated with cancer [30]. Moreover, the expression profile of miRNAs from cancer tissues has been suggested to be prognostic concerning the speed of cancer development and its malignancy [41, 71, 72]. A correlation between the expression of particular miRNAs and their effects on target oncogenes followed by tumourigenesis is beginning to gain evidence. Of particular interest is the possibility that the growth of cancer cells can be repressed by artificial modulation of the level of miRNAs [7375]. Despite the accelerated research interest in the miRNA-regulation, there are only a few examples where an oncogene or a tumour suppressor has been identified as a miRNA target and the regulatory connection validated [40, 51, 53, 54]. Our results indicate that the expression of the c-MYC gene, which is one of the critical oncogenes, is modulated by let-7, expanding the number of validated oncomirs.

Since the significant increase of miRNA targets, all previous validations (including some "oncomirs") have been gathered by Sethupathy at al, in a database called TarBase [60]. The assay of luciferase as a reporter gene has been widely used for the verification of human targets; more than 80% of human targets in the TarBase were validated by this method. However, this validation system has variations depending on the inserted fragment of the target 3'UTR. Either the full-length 3'UTR of mRNA [40, 53, 76], or only a segment containing the binding site [23, 51], or even only the miRNA predicted binding site [22, 52] has been inserted in appropriate reporter constructs. Insertion of multiple binding sites should ensure higher efficiency of the sensor used, since cooperativity of multiple miRNA binding sites has been reported [77, 78]. However, the degree of miRNA-mediated translational repression may depend also on different factors, for example particular miRNA and mRNA concentrations, the accessibility of the binding site and its context [22]. Moreover, the validations mentioned above were achieved by different experimental techniques and for different miRNAs, making it difficult to compare the results.

In the present work we have used synthetically designed miRNA-binding sites for miRNAs of interest, cloned downstream of the luciferase reporter gene. We have tested constructs with single and triple binding sites. We were somewhat surprised to find that a considerable down-regulation was achieved even when sensors carried only one binding site, without the addition of miRNA precursors. A significant repression was observed for both c-MYC and BCL-2 single binding sites. The miRNAs studied here, let-7c and miR-16, are predicted to interact with their potential binding sites c-MYC and BCL-2 respectively, in a so-called canonical interaction, in agreement with the report that the canonical sites have higher binding energy and may be more efficient suppressors [26]. However, the use of triplet constructs not only resulted in the stronger regulation but also ensured more reproducible outcome. Moreover, we could show that the predicted miRNA binding site functions in the context of the entire 3'UTR. Cloning of the whole c-MYC 3'UTR into the luciferase vector resulted in a very strong reduction of the luciferase activity, the strongest effect observed in our set of experiments. Mutagenesis of two nucleotides in the let-7c binding site (nt 3 and 5 in the seed region) could only marginally restore the luciferase activity, although the same mutations caused significant upregulation of luciferase expression in the b.s construct (Fig 3D). This indicates that other miRNA binding sites present in the c-MYC 3'UTR cooperate in the modulation of gene expression. Indeed, other miRNA binding sites have been bioinformatically identified in the c-MYC 3'UTR (not shown). We believe that the interaction studied here, let-7c/c-MYC (pos. 114 of the UTR) is the strongest and the most important for the regulation of c-MYC expression, however, miRNAs are likely to contribute to the regulation of cMYC.

Although now there are many programmes established for the computational prediction of miRNA targets (reviewed in [79]), the large number of predicted targets makes it difficult to choose the best candidates for further experimental verification in a biological system. The advantage of our bioinformatics approach is the possibility of relatively fast, manual scanning of the secondary structures formed by analysed pairs of putative interactors through the use of the RNAfold dot-and-bracket format. It is worth noticing, that in the results list of our scanning important oncogenes can be found (for example BCL-2 and RAS), that have already been proven as targets for particular miRNA (see Additional file 1). Such an outcome supports the suitability of the scanning algorithm used here.

So far, only a handful of miRNAs and their targets have been characterized in detail. Although the BCL-2/miR-16 interaction has been already shown [51], we demonstrate it here with the use of BCL-2 binding site for miR-16 only and not BCL-2 3'UTR segment of 546 bp, as before [51]. Here we demonstrate that c-MYC is targeted by let-7. We show that 22-nt sequence from the c-MYC 3'UTR, predicted to be a binding site for let-7c, is enough to cause down-regulation of a reporter gene in HeLa cells. In addition, suppression of let-7 miRNAs in these cells by anti-let-7 significantly recovers reporter gene expression. Moreover, the suppression of let-7 in HeLa affects also the expression of the endogenous c-MYC, leading to an increase at both mRNA and protein levels. Mammalian miRNAs affecting target mRNA levels in addition to protein levels have been reported before [40, 80] although there are also examples of endogenous mammalian mRNAs that are regulated by miRNAs at the level of translation without any change in target mRNA levels [51, 55].

Based on our analysis it is not possible to specify which member(s) of the let-7 family is (are) responsible for the down-regulation of c-MYC. Let-7c, let-7b and let-7i (all with theoretically good efficiency) may bind to the same site in 3'UTR of c-MYC (Table 2). Biological data may give some clues as to which of the let-7 family members may be more likely to interact with c-MYC in vivo. In 80% of breast cancers, c-MYC is over-expressed, indicating that its potential miRNA regulator could be down-regulated in these cases. However, the expression level of let-7b both in normal and cancer breast tissues is the same [32]. Moreover, the down-regulation of let-7 family members (including let-7c but excluding let-7b) has been reported elsewhere for breast cancer [46]. In this last report, the down-regulation of let-7 was shown to correlate with metastasis or higher proliferation index, which could additionally support our hypothesis for c-MYC involvement [46]. Furthermore, the next evidence for our prediction of c-MYC/let-7c interaction is the fact that frequent deletions in chromosome 21 (21q21) have been reported in cases of lung and colorectal carcinomas and their metastases [8184]. The same genomic location is shared by the let-7c gene, while the other candidates such as let-7b or 7i are located on chromosomes 12 and 22, respectively. The deletions in a region coding let-7c would be the simplest explanation for the reduced level of let-7c in cancer tissues, the miRNA diminishing the activity of c-MYC, therefore contributing to the enhanced proliferation and tumourigenesis.

Table 2 Possible let-7 family members that can interact with 3'UTR of c-MYC

It has been shown that the concentration of the MYC protein is critical for the conversion, persistence or regression of the liver tumours [85]. The cause of spontaneous c-MYC up-regulation is not yet clear. Calin at al. proposed that chromosomal translocation could bring MYC genes under the control of promoters for microRNAs, so that the gene will be over-expressed [39]. An alternative trigger for c-MYC over-expression could be reduced activity of the regulator, such as a let-7c that negatively modulates gene expression at translational level. Spontaneous c-MYC over-expression could be therefore the result of down-regulation or loss of specific let-7 loci.

Although at present a comprehensive picture of the regulatory function of the let-7 miRNA family cannot be drawn, it is tempting to speculate on possible roles for this miRNA family in a complex network of interacting, proproliferative/proapoptotic factors. Mounting evidence shows that the expression of the RAS oncogene is regulated by let-7, and that RAS is significantly over-expressed in lung tumour samples [40]. The 3'UTRs of the human RAS genes contain multiple let-7 complementary sites, allowing let-7 to regulate RAS [40]. In humans, let-7 is expressed in normal adult lung tissue but poorly expressed in case of lung cancers [40, 71], which suggests that this miRNA may function also as a tumour suppressor. Moreover, it has been shown that over-expression of let-7 inhibited cell growth of a lung cancer cell line in vitro [71]. However, the mechanism by which let-7 regulates cell cycle is unknown. c-MYC is another important oncogene with the ability to induce both cell proliferation and apoptosis [86]. In addition, RAS and c-MYC function together – both are key components of the signaling pathway, regulated by the mitogen activated protein kinases (MAPK) [87, 88]. It has been reported that induction of c-MYC expression correlates with induction of miR-17 cluster, consisting of six miRNAs: 17-5p, -18, -19a, -19b, -20 and -92 [31]. Moreover, c-MYC regulates the transcription of miRNAs from miR-17 cluster and two of them (miR-17-5p and miR-20) regulate transcription factor E2F1 at the translational level [52], which is also transcriptionally activated by c-MYC [89].


A large number of potential miRNA target sites in 54.8% (80/149) of human oncogenes has been proposed and presented here based on an in silico analysis. Targets for different oncomirs, validation of which would be of special interest, have been presented. Moreover, two predicted interactions (cMYC/let7 and BCL2/miR-16) have been tested experimentally in a reporter gene assay, which presently seems to be the "gold-standard" method to validate miRNA::target interactions. Both let-7 and miR-16 have been shown to downregulate their target oncogenes, c-MYC and BCL-2, respectively. Given the known importance of the regulatory miRNA we tested (let-7) and the targeted oncogene (c-MYC) studied, the validation of a let-7/c-MYC interaction may be of particular interest. The miRNAs that are encoded by let-7 family are conserved between mammalian species, both at the sequence level and at their temporal expression patterns, which probably indicates their general role in gene regulation [16]. The c-MYC transcription factor, on the other hand, is one of the most potent and frequently deregulated oncoproteins in human cancers [90, 91], therefore its deregulation is regarded as a hallmark of many cancers (reviewed in [92]).


Retrieving the Homo sapiens UTRs sequences

The UTR sequences were retrieved and collected by accurate parsing from EMBL/GenBank and "UTR Database" (UTRdb, release 15.0) [9396]. The whole human 3'UTR dataset was provided as a multi-GenBank file. The current GeneBank format was converted to a FASTA file using BioPerl modules for biological database parsing.

Extraction of the oncogenes

For the gathering of all oncogenes (and also some other cancer related sequences) a Perl script was developed, for parsing the local dataset files and making the onco-collection of sequences. Entries were scanned and collected by description (definition and keywords fields) from the original GenBank entries. The local database of oncogenes was extended by some sequences which were obtained from EMBL nucleotide sequence database. The final set of sequences, containing 146 entries, was structured as a multi-FASTA format file.

miRNA binding site analysis and 2D shape filtering of RNA duplexes

All oncogene sequences were scanned with the core algorithm of microInspector [97]. Using the program as command line script, the software was able to process whole sets of sequences and analyse them for all possible human miRNA binding sites. The folding temperature was set to 37°C. We used a cut-off value -18 kcal/mol. For the miRNAs database we selected all Homo sapiens sequences from the "miRNA Registry" Release 7.1 [98].

The outcome results were subjected to further examination by considering the suggested properties of animal miRNA binding sites [59] using an external Perl filter. The minimal pairing in the seed was set as 6 nucleotides, independently of nucleotide at position one. Following the main central loop/bulge (which was considered optional) the filter allowed structures having full complementarity or only few (up to 3) unpaired nucleotides at the 3' end (Fig. 5).

Figure 5

Preferred structure for the external filter. Outline of the miRNA-target structure selected by the external filter. The structure selected by the filter should have full complementarity in the 5'miRNA-end, optionally a central loop/bulge and good 3' pairing with up to three mismatches.

Vectors and DNA constructs

To generate reporter vectors bearing miRNA-binding sites, a mammalian expression vector phRL-TK (Promega, Madison, US) carrying the Renilla luciferase gene (hRluc) as a reporter was used. It was modified in such a way to protect from re-ligation, thus simplifying the cloning of short sequences. Double restriction sites for Bst EII enzyme were inserted downstream from the stop codon of the luciferase gene. Specific oligonucleotides having Bst EII ends and containing binding sites (single or triple repeats) for the analysed microRNAs: c-MYC b.s. for let-7c and BCL-2 b.s. for miR-16 were generated (Metabion, Martinsried, Germany). The appropriate oligos were then annealed by boiling and gradually cooling down, phosphorylated and cloned into the modified phRL-TK-Bst EII vector at the Bst EII sites downstream of hRluc gene (Fig. 2). For all sensor constructs three types of cassettes were prepared and studied side by side: wild type (WT), carrying mutations (MUT) and perfect match (PM). In addition, to check whether the potential miRNA binding sites function in the context of the entire 3'UTR, the whole c-MYC 3'UTR was cloned into the same luciferase vector (at Xba I – Not I restriction sites) using the following primers: Fw-5'ACTCTAGATGCGTAAGGAAAAGTAAGGA and Rev-5'AAGGCCGCATGATATATTTGCCAGTTATT. Moreover, point mutations in the potential let-7c binding site were inserted in the same positions as for the construct carrying let-7c b.s only (seed region, pos. 3rd and 5th; compare Fig. 1B), using QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and primer sequence: 5'-TAGCCATAATGTAAACTGA CC CAAATTGGACTTTGGGCA. All constructs were verified by sequencing. Additionally, anti-let-7c (Dharmacon, Chicago, USA) was used to inhibit the expression of let-7c. The sequences used in our studies are listed in the Additional files (Additional file 4). Positions of mutations in the MUT constructs are indicated in bold letters.

Transfection assay

Human HeLa 229 cell line (LGC Promochem, ATCC Number: CCL-2.1) was grown in Dulbecco's Modified Eagle's Medium (DMEM) with 10% fetal bovine serum (FBS) and gentamycine (50 μg/ml) at 37°C, in a humified atmosphere of 5% CO2. The cells were transfected in the 12-well plates in serum-free DMEM by using Lipofectamine 2000 (Invitrogen, Carlsbad, California) or siIMPORTER, siRNA and Plasmid DNA Transfection Reagent (Upstate, Charlottesville, USA), according to manufacturers' instructions. For each transfection experiment, 100 ng of appropriate sensor construct and 500 ng of normalization vector pCMVβ (Clontech, Mountain View, USA) expressing β-galactosidase were used in order to obtain optimal results. β-gal vector was used as a control for transfection efficiency. HeLa cells were also transfected with the phRL-TK-BstE II vector lacking miRNA-binding sites to demonstrate the standard luciferase activity. Cells were harvested 48 h after transfection and assayed both for luciferase activity and β-gal expression. The luciferase activity was measured using Renilla Luciferase Assay System (Promega, Madison, USA) with a FB 12 Luminometer (Berthold Detection Systems, USA). For the inhibition of endogenous let-7c miRNA in HeLa cells the transfection of anti-let-7c oligo (Dharmacon) at a final concentratration of 50 nM was performed, using siIMPORTER reagent (Upstate) according to manufacturers instructions. Cells were harvested 48 h after transfection and used for northern and western analyses. Inhibition of endogenous let-7c in order to restore luciferase activity of sensor constructs (Additional file 3) was achieved using the concentration of antisense let-7c oligo, as indicated in the figure. To provide an equal amount of transfected DNA the GAPAS oligo (GTGGATATTGTTGCCATCA), reported not to target any cellular miRNA, was used [66].

Figures for the tranfection assays were made by summarizing all repeats for the particular construct. Values for error bars were calculated using a formula for standard error of the mean, which is the standard deviation of the sampling distribution of the mean. The formula for the standard error of the mean is: σM = σ/√N, where σ is the standard deviation of the original distribution and N is the sample size (the repetition number).

Northern and Western blot analyses

Total RNA was extracted from HeLa cells using Trizol Reagent (Invitrogen). Northern blot was performed as described before [99]. For probing, DNA fragments corresponding to c-MYC 3'UTR and 18S rRNA (a loading control) were labelled by random primed incorporation of [32-P] dATP and dCTP (RadPrime DNA Labelling System, Invitrogen).

For the Western analysis total protein extracts from HeLa cells were used. 48 h after transfection cells were lysed with EBC buffer (50 mM Tris pH-8, 170 mM NaCl, 0.5 % NP 40, 50 mM NaF) supplemented with protease inhibitors. 30 μg of protein lysate was separated by 10% SDS-PAGE and transferred to PROTRAN nitrocellulose membrane (Schleicher & Schuell) in 25 mM Tris, 200 mM glycine, 20% methanol, at 30 V overnight at 4°C. After blocking nonspecific binding sites with 5 % nonfat milk in PBS/Tween, the membrane was incubated for 2 h at RT with primary antibody anti-cMYC (monoclonal, diluted 1:200) and then for 1 h with the secondary anti-mouse antibody (alkaline peroxidase-conjugate, diluted 1:10000). After washing in PBS/Tween, the detection was performed using SuperSignal WestPico Trial Kit (Pierce, Rockford, IL, USA)

Note added in proof

During the review process, work by Kumar et al. (doi: 10.1038/ng2003; 2007) was published showing that global repression of miRNA maturation promotes cellular transformation and tumorigenesis. They correlate this processes with the lack of let7 regulation on the RAS and cMYC genes.



microRNA, b.s: miRNA binding site

BCL-2 :

B-cell leukemia/lymphoma 2

c-MYC :

v-myc myelocytomatosis viral oncogene homolog (avian)


  1. 1.

    Benfey PN: Molecular biology: microRNA is here to stay. Nature 2003,425(6955):244-245. 10.1038/425244a

  2. 2.

    Jones-Rhoades MW, Bartel DP, Bartel B: MicroRNAs and their regulatory roles in plants. Annu Rev Plant Biol 2006, 57: 19-53. 10.1146/annurev.arplant.57.032905.105218

  3. 3.

    Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE: The colorectal microRNAome. Proc Natl Acad Sci USA 2006,103(10):3687-3692. 10.1073/pnas.0511155103

  4. 4.

    Nelson P, Kiriakidou M, Sharma A, Maniataki E, Mourelatos Z: The microRNA world: small is mighty. Trends Biochem Sci 2003,28(10):534-540. 10.1016/j.tibs.2003.08.005

  5. 5.

    Sevignani C, Calin GA, Siracusa LD, Croce CM: Mammalian microRNAs: a small world for fine-tuning gene expression. Mamm Genome 2006,17(3):189-202. 10.1007/s00335-005-0066-3

  6. 6.

    Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E: Phylogenetic shadowing and computational identification of human microRNA genes. Cell 2005,120(1):21-24. 10.1016/j.cell.2004.12.031

  7. 7.

    Palatnik JF, Allen E, Wu X, Schommer C, Schwab R, Carrington JC, Weigel D: Control of leaf morphogenesis by microRNAs. Nature 2003,425(6955):257-263. 10.1038/nature01958

  8. 8.

    Silva JM, Hammond SM, Hannon GJ: RNA interference: a promising approach to antiviral therapy? Trends Mol Med 2002,8(11):505-508. 10.1016/S1471-4914(02)02421-8

  9. 9.

    Tang G, Reinhart BJ, Bartel DP, Zamore PD: A biochemical framework for RNA silencing in plants. Genes Dev 2003,17(1):49-63. 10.1101/gad.1048103

  10. 10.

    Yekta S, Shih IH, Bartel DP: MicroRNA-directed cleavage of HOXB8 mRNA. Science 2004,304(5670):594-596. 10.1126/science.1097434

  11. 11.

    Ambros V: Control of developmental timing in Caenorhabditis elegans. Curr Opin Genet Dev 2000,10(4):428-433. 10.1016/S0959-437X(00)00108-8

  12. 12.

    Brennecke J, Cohen SM: Towards a complete description of the microRNA complement of animal genomes. Genome Biol 2003,4(9):228. 10.1186/gb-2003-4-9-228

  13. 13.

    Lee RC, Feinbaum RL, Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993,75(5):843-854. 10.1016/0092-8674(93)90529-Y

  14. 14.

    Olsen PH, Ambros V: The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev Biol 1999,216(2):671-680. 10.1006/dbio.1999.9523

  15. 15.

    Pasquinelli AE, Ruvkun G: Control of developmental timing by micrornas and their targets. Annu Rev Cell Dev Biol 2002, 18: 495-513. 10.1146/annurev.cellbio.18.012502.105832

  16. 16.

    Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda MI, Maller B, Hayward DC, Ball EE, Degnan B, Muller P, Spring J, Srinivasan A, Fishman M, Finnerty J, Corbo J, Levine M, Leahy P, Davidson E, Ruvkun G: Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 2000,408(6808):86-89. 10.1038/35040556

  17. 17.

    Pillai RS, Bhattacharyya SN, Artus CG, Zoller T, Cougot N, Basyuk E, Bertrand E, Filipowicz W: Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science 2005,309(5740):1573-1576. 10.1126/science.1115079

  18. 18.

    Petersen CP, Bordeleau ME, Pelletier J, Sharp PA: Short RNAs repress translation after initiation in mammalian cells. Mol Cell 2006,21(4):533-542. 10.1016/j.molcel.2006.01.031

  19. 19.

    Wu L, Fan J, Belasco JG: MicroRNAs direct rapid deadenylation of mRNA. Proc Natl Acad Sci USA 2006,103(11):4034-4039. 10.1073/pnas.0510928103

  20. 20.

    Giraldez AJ, Mishima Y, Rihel J, Grocock RJ, Van Dongen S, Inoue K, Enright AJ, Schier AF: Zebrafish MiR-430 promotes deadenylation and clearance of maternal mRNAs. Science 2006,312(5770):75-79. 10.1126/science.1122689

  21. 21.

    Doench JG, Sharp PA: Specificity of microRNA target selection in translational repression. Genes Dev 2004,18(5):504-511. 10.1101/gad.1184404

  22. 22.

    Kiriakidou M, Nelson PT, Kouranov A, Fitziev P, Bouyioukos C, Mourelatos Z, Hatzigeorgiou A: A combined computational-experimental approach predicts human microRNA targets. Genes Dev 2004,18(10):1165-1178. 10.1101/gad.1184704

  23. 23.

    Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burge CB: Prediction of mammalian microRNA targets. Cell 2003,115(7):787-798. 10.1016/S0092-8674(03)01018-3

  24. 24.

    Saxena S, Jonsson ZO, Dutta A: Small RNAs with imperfect match to endogenous mRNA repress translation. Implications for off-target activity of small inhibitory RNA in mammalian cells. J Biol Chem 2003,278(45):44312-44319. 10.1074/jbc.M307089200

  25. 25.

    Brennecke J, Hipfner DR, Stark A, Russell RB, Cohen SM: bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 2003,113(1):25-36. 10.1016/S0092-8674(03)00231-9

  26. 26.

    Brennecke J, Stark A, Russell RB, Cohen SM: Principles of microRNA-target recognition. PLoS Biol 2005,3(3):e85. 10.1371/journal.pbio.0030085

  27. 27.

    Lee RC, Ambros V: An extensive class of small RNAs in Caenorhabditis elegans. Science 2001,294(5543):862-864. 10.1126/science.1065329

  28. 28.

    Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T: Identification of tissue-specific microRNAs from mouse. Curr Biol 2002,12(9):735-739. 10.1016/S0960-9822(02)00809-6

  29. 29.

    Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, Ambros V: Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol 2004,5(3):R13. 10.1186/gb-2004-5-3-r13

  30. 30.

    Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing JR, Jacks T, Horvitz HR, Golub TR: MicroRNA expression profiles classify human cancers. Nature 2005,435(7043):834-838. 10.1038/nature03702

  31. 31.

    He L, Thomson JM, Hemann MT, Hernando-Monge E, Mu D, Goodson S, Powers S, Cordon-Cardo C, Lowe SW, Hannon GJ, Hammond SM: A microRNA polycistron as a potential human oncogene. Nature 2005,435(7043):828-833. 10.1038/nature03552

  32. 32.

    Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio M, Roldo C, Ferracin M, Prueitt RL, Yanaihara N, Lanza G, Scarpa A, Vecchione A, Negrini M, Harris CC, Croce CM: A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA 2006,103(7):2257-2261. 10.1073/pnas.0510565103

  33. 33.

    Zhang L, Huang J, Yang N, Greshock J, Megraw MS, Giannakakis A, Liang S, Naylor TL, Barchetti A, Ward MR, Yao G, Medina A, O'Brien-Jenkins A, Katsaros D, Hatzigeorgiou A, Gimotty PA, Weber BL, Coukos G: microRNAs exhibit high frequency genomic alterations in human cancer. Proc Natl Acad Sci USA 2006.

  34. 34.

    Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, Shimizu M, Rattan S, Bullrich F, Negrini M, Croce CM: Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci USA 2004,101(9):2999-3004. 10.1073/pnas.0307323101

  35. 35.

    Esquela-Kerscher A, Slack FJ: Oncomirs – microRNAs with a role in cancer. Nat Rev Cancer 2006,6(4):259-269. 10.1038/nrc1840

  36. 36.

    Lee YS, Dutta A: MicroRNAs: small but potent oncogenes or tumor suppressors. Curr Opin Investig Drugs 2006,7(6):560-564.

  37. 37.

    Gartel AL, Kandel ES: RNA interference in cancer. Biomol Eng 2006,23(1):17-34. 10.1016/j.bioeng.2006.01.002

  38. 38.

    Hwang HW, Mendell JT: MicroRNAs in cell proliferation, cell death, and tumorigenesis. Br J Cancer 2006,94(6):776-780. 10.1038/sj.bjc.6603023

  39. 39.

    Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM: Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci USA 2002,99(24):15524-15529. 10.1073/pnas.242606799

  40. 40.

    Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ: RAS is regulated by the let-7 microRNA family. Cell 2005,120(5):635-647. 10.1016/j.cell.2005.01.014

  41. 41.

    Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, Stephens RM, Okamoto A, Yokota J, Tanaka T, Calin GA, Liu CG, Croce CM, Harris CC: Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 2006,9(3):189-198. 10.1016/j.ccr.2006.01.025

  42. 42.

    Ota A, Tagawa H, Karnan S, Tsuzuki S, Karpas A, Kira S, Yoshida Y, Seto M: Identification and characterization of a novel gene, C13orf25, as a target for 13q31-q32 amplification in malignant lymphoma. Cancer Res 2004,64(9):3087-3095. 10.1158/0008-5472.CAN-03-3773

  43. 43.

    Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T: A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res 2005,65(21):9628-9632. 10.1158/0008-5472.CAN-05-2352

  44. 44.

    Chan JA, Krichevsky AM, Kosik KS: MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res 2005,65(14):6029-6033. 10.1158/0008-5472.CAN-05-0137

  45. 45.

    Ciafre SA, Galardi S, Mangiola A, Ferracin M, Liu CG, Sabatino G, Negrini M, Maira G, Croce CM, Farace MG: Extensive modulation of a set of microRNAs in primary glioblastoma. Biochem Biophys Res Commun 2005,334(4):1351-1358. 10.1016/j.bbrc.2005.07.030

  46. 46.

    Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, Menard S, Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin GA, Querzoli P, Negrini M, Croce CM: MicroRNA gene expression deregulation in human breast cancer. Cancer Res 2005,65(16):7065-7070. 10.1158/0008-5472.CAN-05-1783

  47. 47.

    Michael MZ, SM OC, van Holst Pellekaan NG, Young GP, James RJ: Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res 2003,1(12):882-891.

  48. 48.

    Metzler M, Wilda M, Busch K, Viehmann S, Borkhardt A: High expression of precursor microRNA-155/BIC RNA in children with Burkitt lymphoma. Genes Chromosomes Cancer 2004,39(2):167-169. 10.1002/gcc.10316

  49. 49.

    Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E, Dahlberg JE: Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci USA 2005,102(10):3627-3632. 10.1073/pnas.0500613102

  50. 50.

    Kluiver J, Haralambieva E, de Jong D, Blokzijl T, Jacobs S, Kroesen BJ, Poppema S, van den Berg A: Lack of BIC and microRNA miR-155 expression in primary cases of Burkitt lymphoma. Genes Chromosomes Cancer 2006,45(2):147-153. 10.1002/gcc.20273

  51. 51.

    Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, Wojcik SE, Aqeilan RI, Zupo S, Dono M, Rassenti L, Alder H, Volinia S, Liu CG, Kipps TJ, Negrini M, Croce CM: miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci USA 2005,102(39):13944-13949. 10.1073/pnas.0506654102

  52. 52.

    O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT: c-Myc-regulated microRNAs modulate E2F1 expression. Nature 2005,435(7043):839-843. 10.1038/nature03677

  53. 53.

    Felli N, Fontana L, Pelosi E, Botta R, Bonci D, Facchiano F, Liuzzi F, Lulli V, Morsilli O, Santoro S, Valtieri M, Calin GA, Liu CG, Sorrentino A, Croce CM, Peschle C: MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation. Proc Natl Acad Sci USA 2005,102(50):18081-18086. 10.1073/pnas.0506216102

  54. 54.

    Voorhoeve PM, le Sage C, Schrier M, Gillis AJ, Stoop H, Nagel R, Liu YP, van Duijse J, Drost J, Griekspoor A, Zlotorynski E, Yabuta N, De Vita G, Nojima H, Looijenga LH, Agami R: A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell 2006,124(6):1169-1181. 10.1016/j.cell.2006.02.037

  55. 55.

    Saito Y, Liang G, Egger G, Friedman JM, Chuang JC, Coetzee GA, Jones PA: Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. Cancer Cell 2006,9(6):435-443. 10.1016/j.ccr.2006.04.020

  56. 56.

    Lai EC: Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation. Nat Genet 2002,30(4):363-364. 10.1038/ng865

  57. 57.

    Vella MC, Choi EY, Lin SY, Reinert K, Slack FJ: The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3'UTR. Genes Dev 2004,18(2):132-137. 10.1101/gad.1165404

  58. 58.

    Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP: The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Science 2005,310(5755):1817-1821. 10.1126/science.1121158

  59. 59.

    Brennecke J, Stark A, Cohen SM: Not miR-ly muscular: microRNAs and muscle development. Genes Dev 2005,19(19):2261-2264. 10.1101/gad.1363905

  60. 60.

    Sethupathy P, Corda B, Hatzigeorgiou AG: TarBase: A comprehensive database of experimentally supported animal microRNA targets. Rna 2006,12(2):192-197. 10.1261/rna.2239606

  61. 61.

    Robins H, Press WH: Human microRNAs target a functionally distinct population of genes with AT-rich 3' UTRs. Proc Natl Acad Sci USA 2005,102(43):15557-15562. 10.1073/pnas.0507443102

  62. 62.

    Baskerville S, Bartel DP: Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes. Rna 2005,11(3):241-247. 10.1261/rna.7240905

  63. 63.

    Fegan C: Molecular abnormalities in B-cell chronic lymphocytic leukaemia. Clin Lab Haematol 2001,23(3):139-148. 10.1046/j.1365-2257.2001.00395.x

  64. 64.

    Fink SR, Smoley SA, Stockero KJ, Paternoster SF, Thorland EC, Van Dyke DL, Shanafelt TD, Zent CS, Call TG, Kay NE, Dewald GW: Loss of TP53 is due to rearrangements involving chromosome region 17p10 approximately p12 in chronic lymphocytic leukemia. Cancer Genet Cytogenet 2006,167(2):177-181. 10.1016/j.cancergencyto.2006.01.005

  65. 65.

    Stilgenbauer S, Lichter P, Dohner H: Genetic features of B-cell chronic lymphocytic leukemia. Rev Clin Exp Hematol 2000,4(1):48-72. 10.1046/j.1468-0734.2000.00003.x

  66. 66.

    Cheng AM, Byrom MW, Shelton J, Ford LP: Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic Acids Res 2005,33(4):1290-1297. 10.1093/nar/gki200

  67. 67.

    Zeng Y, Yi R, Cullen BR: MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci USA 2003,100(17):9779-9784. 10.1073/pnas.1630797100

  68. 68.

    Hutvagner G, Simard MJ, Mello CC, Zamore PD: Sequence-specific inhibition of small RNA function. PLoS Biol 2004,2(4):E98. 10.1371/journal.pbio.0020098

  69. 69.

    Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ: miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res 2006, (34 Database):D140-144. 10.1093/nar/gkj112

  70. 70.

    Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z: Identification of hundreds of conserved and nonconserved human microRNAs. Nat Genet 2005,37(7):766-770. 10.1038/ng1590

  71. 71.

    Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, Mitsudomi T, Takahashi T: Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res 2004,64(11):3753-3756. 10.1158/0008-5472.CAN-04-0637

  72. 72.

    Calin GA, Ferracin M, Cimmino A, Di Leva G, Shimizu M, Wojcik SE, Iorio MV, Visone R, Sever NI, Fabbri M, Iuliano R, Palumbo T, Pichiorri F, Roldo C, Garzon R, Sevignani C, Rassenti L, Alder H, Volinia S, Liu CG, Kipps TJ, Negrini M, Croce CM: A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med 2005,353(17):1793-1801. 10.1056/NEJMoa050995

  73. 73.

    Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, Stoffel M: Silencing of microRNAs in vivo with 'antagomirs'. Nature 2005,438(7068):685-689. 10.1038/nature04303

  74. 74.

    Hammond SM: MicroRNA therapeutics: a new niche for antisense nucleic acids. Trends Mol Med 2006,12(3):99-101. 10.1016/j.molmed.2006.01.004

  75. 75.

    Weiler J, Hunziker J, Hall J: Anti-miRNA oligonucleotides (AMOs): ammunition to target miRNAs implicated in human disease? Gene Ther 2006,13(6):496-502. 10.1038/

  76. 76.

    Leaman D, Chen PY, Fak J, Yalcin A, Pearce M, Unnerstall U, Marks DS, Sander C, Tuschl T, Gaul U: Antisense-mediated depletion reveals essential and specific functions of microRNAs in Drosophila development. Cell 2005,121(7):1097-1108. 10.1016/j.cell.2005.04.016

  77. 77.

    Ha I, Wightman B, Ruvkun G: A bulged lin-4/lin-14 RNA duplex is sufficient for Caenorhabditis elegans lin-14 temporal gradient formation. Genes Dev 1996,10(23):3041-3050. 10.1101/gad.10.23.3041

  78. 78.

    Doench JG, Petersen CP, Sharp PA: siRNAs can function as miRNAs. Genes Dev 2003,17(4):438-442. 10.1101/gad.1064703

  79. 79.

    Bentwich I: Prediction and validation of microRNAs and their targets. FEBS Lett 2005,579(26):5904-5910. 10.1016/j.febslet.2005.09.040

  80. 80.

    Baroukh N, Ravier MA, Loder MK, Hill EV, Bounacer A, Scharfmann R, Rutter GA, Van Obberghen E: MicroRNA-124a regulates Foxa2 expression and intracellular signaling in pancreatic beta-cell lines. J Biol Chem 2007,282(27):19575-19588. 10.1074/jbc.M611841200

  81. 81.

    Knosel T, Schluns K, Dietel M, Petersen I: Chromosomal alterations in lung metastases of colorectal carcinomas: associations with tissue specific tumor dissemination. Clin Exp Metastasis 2005,22(7):533-538. 10.1007/s10585-005-5239-7

  82. 82.

    Knosel T, Petersen S, Schwabe H, Schluns K, Stein U, Schlag PM, Dietel M, Petersen I: Incidence of chromosomal imbalances in advanced colorectal carcinomas and their metastases. Virchows Arch 2002,440(2):187-194. 10.1007/s004280100493

  83. 83.

    Kohno T, Kawanishi M, Matsuda S, Ichikawa H, Takada M, Ohki M, Yamamoto T, Yokota J: Homozygous deletion and frequent allelic loss of the 21q11.1-q21.1 region including the ANA gene in human lung carcinoma. Genes Chromosomes Cancer 1998,21(3):236-243. 10.1002/(SICI)1098-2264(199803)21:3<236::AID-GCC8>3.0.CO;2-0

  84. 84.

    Sato M, Takahashi K, Nagayama K, Arai Y, Ito N, Okada M, Minna JD, Yokota J, Kohno T: Identification of chromosome arm 9p as the most frequent target of homozygous deletions in lung cancer. Genes Chromosomes Cancer 2005,44(4):405-414. 10.1002/gcc.20253

  85. 85.

    Shachaf CM, Kopelman AM, Arvanitis C, Karlsson A, Beer S, Mandl S, Bachmann MH, Borowsky AD, Ruebner B, Cardiff RD, Yang Q, Bishop JM, Contag CH, Felsher DW: MYC inactivation uncovers pluripotent differentiation and tumour dormancy in hepatocellular cancer. Nature 2004,431(7012):1112-1117. 10.1038/nature03043

  86. 86.

    Pelengaris S, Khan M, Evan GI: Suppression of Myc-induced apoptosis in beta cells exposes multiple oncogenic properties of Myc and triggers carcinogenic progression. Cell 2002,109(3):321-334. 10.1016/S0092-8674(02)00738-9

  87. 87.

    Seger R, Krebs EG: The MAPK signaling cascade. Faseb J 1995,9(9):726-735.

  88. 88.

    Kerkhoff E, Houben R, Loffler S, Troppmair J, Lee JE, Rapp UR: Regulation of c-myc expression by Ras/Raf signalling. Oncogene 1998,16(2):211-216. 10.1038/sj.onc.1201520

  89. 89.

    Fernandez PC, Frank SR, Wang L, Schroeder M, Liu S, Greene J, Cocito A, Amati B: Genomic targets of the human c-Myc protein. Genes Dev 2003,17(9):1115-1129. 10.1101/gad.1067003

  90. 90.

    Dang CV: c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol Cell Biol 1999,19(1):1-11.

  91. 91.

    Prochownik EV: c-Myc as a therapeutic target in cancer. Expert Rev Anticancer Ther 2004,4(2):289-302. 10.1586/14737140.4.2.289

  92. 92.

    Ponzielli R, Katz S, Barsyte-Lovejoy D, Penn LZ: Cancer therapeutics: targeting the dark side of Myc. Eur J Cancer 2005,41(16):2485-2501. 10.1016/j.ejca.2005.08.017

  93. 93.

    Pesole G, Liuni S, Grillo G, Licciulli F, Mignone F, Gissi C, Saccone C: UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' untranslated regions of eukaryotic mRNAs. Update 2002. Nucleic Acids Res 2002,30(1):335-340. 10.1093/nar/30.1.335

  94. 94.

    Pesole G, Liuni S, Grillo G, Ippedico M, Larizza A, Makalowski W, Saccone C: UTRdb: a specialized database of 5' and 3' untranslated regions of eukaryotic mRNAs. Nucleic Acids Res 1999,27(1):188-191. 10.1093/nar/27.1.188

  95. 95.

    Pesole G, Liuni S, Grillo G, Saccone C: UTRdb: a specialized database of 5'- and 3'-untranslated regions of eukaryotic mRNAs. Nucleic Acids Res 1998,26(1):192-195. 10.1093/nar/26.1.192

  96. 96.

    Mignone F, Grillo G, Licciulli F, Iacono M, Liuni S, Kersey PJ, Duarte J, Saccone C, Pesole G: UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs. Nucleic Acids Res 2005, (33 Database):D141-146.

  97. 97.

    Rusinov V, Baev V, Minkov IN, Tabler M: MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence. Nucleic Acids Res 2005, (33 Web Server):W696-700. 10.1093/nar/gki364

  98. 98.

    Griffiths-Jones S: The microRNA Registry. Nucleic Acids Res 2004, (32 Database):D109-111. 10.1093/nar/gkh023

  99. 99.

    Kalantidis K, Psaradakis S, Tabler M, Tsagris M: The occurrence of CMV-specific short Rnas in transgenic tobacco expressing virus-derived double-stranded RNA is indicative of resistance to the virus. Mol Plant Microbe Interact 2002,15(8):826-833. 10.1094/MPMI.2002.15.8.826

Download references


We are grateful to Witold Filipowicz and Fabrice Kolb and Alexandra Boutla for many helpful suggestions and discussions. We thank Mina Tsagris, Alexandra Boutla and Nikos Vrettos for critical reading of the manuscript, Joseph Papamatheakis for materials and discussions and Nicholas Moschonas for tissue culture facilities. This work was supported by the European Union (contract 2004-005120 FOSRAK).

Author information

Correspondence to Edyta Koscianska or Vesselin Baev or Konstantinia Skreka or Katerina Oikonomaki or Ventsislav Rusinov or Martin Tabler or Kriton Kalantidis.

Additional information

Competing interests

The author(s) declare that there are no competing interests.

Authors' contributions

EK carried out the experimental validation of predicted miRNA interactions and drafted the manuscript. VB performed the in silico analysis and contributed in the preparation of the manuscript. KS, KO and VR participated in the experimental and bioinformatic approaches of the work, respectively. MT conceived the study. KK supervised and coordinated the project and contributed in the preparation of the manuscript. All authors read and approved the final manuscript.

Electronic supplementary material

Additional file 1: Full list of predicted miRNA/oncogene interactions. (XLS 121 KB)

Additional file 2: Predicted interactions of different human and murine MYC mRNAs with miRNAs of the let-7 family. GeneBank accession numbers and the positions of the binding motifs (all within the 3'UTR) and the calculated free energies are indicated. (JPEG 1 MB)

Additional file 3: Luciferase activity following transfections of reporter constructs with let-7c microRNA inhibitor. Constructs used for the validation of let7c/c-MYC interaction (WT, MUT and PM) were co-transfected into HeLa cells together with anti-let-7c inhibitor at two different concentrations, as indicated in the figure. Results are presented in % (100% – luciferase vector with no binding site). To provide an equal amount of transfected DNA the GAPAS oligo, not targeting any cellular miRNA, was used [66]. (JPEG 494 KB)

Additional file 4: Sequences of oligos used to create sensor constructs carrying c-MYC b.s. for let-7c and BCL-2 b.s. for miR-16. Three types of cassettes (WT, MUT and PM) were constructed as described in the text. Positions of mutations in the MUT constructs are indicated in bold, underlined letters. Abbreviations 1 bs and 3 bs stand for single and triple binding site, respectively. Sense or antisense strand of the oligo is indicated by letters A and B. (XLS 18 KB)

Authors’ original submitted files for images

Rights and permissions

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and Permissions

About this article

Cite this article

Koscianska, E., Baev, V., Skreka, K. et al. Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Molecular Biol 8, 79 (2007) doi:10.1186/1471-2199-8-79

Download citation


  • HeLa Cell
  • Luciferase Activity
  • miRNA Target
  • miRNA Binding Site
  • miRNA Target Site