Extraordinary diversity among members of the large gene family, 185/333, from the purple sea urchin, Strongylocentrotus purpuratus
- Katherine M Buckley1Email author and
- L Courtney Smith1Email author
https://doi.org/10.1186/1471-2199-8-68
© Buckley and Smith; licensee BioMed Central Ltd. 2007
Received: 31 May 2007
Accepted: 15 August 2007
Published: 15 August 2007
Abstract
Background
Recent analysis of immune-related genes within the sea urchin genome revealed a number of large gene families with vertebrate homologues, such as the Toll-like and NOD/NALP-like receptor families and C-type lectins in addition to a rudimentary complement system. Therefore, the immune response of the purple sea urchin appears to be more complex than previously believed. Another component of the sea urchin immune response is an unusual family of mRNAs, known as 185/333, which is strongly upregulated in response to pathogen challenge. The work presented here indicates that this family of transcripts is derived from an unexpectedly diverse gene family.
Results
The 185/333 genes are small (< 2 kb) with only two exons. Their extraordinary diversity was exemplified by 121 unique sequences identified from 171 cloned genes. Sequences from the second exons were aligned optimally by introducing large gaps, which defined blocks of sequence known as elements. Genes were defined by the presence or absence of elements. Phylogenetic analysis defined five intron types which, when combined with the exon element patterns resulted in 31 gene patterns, 14 of which were not described previously. Sequence diversity was present in all elements, and was higher in the intron than the exons. Repeats within the sequence facilitated multiple alignments, of which two were analyzed in detail. Although the two alignments differed in length, number of elements, and number of patterns, both were about equally accurate at describing the 185/333 sequences. The genes were closely linked and flanked by short repeats. The repeats within and between the genes may promote their diversification through gene conversion, recombination, and meiotic mispairing.
Conclusion
The diversity of the 185/333 gene family represents an intriguing addition to what is known about the S. purpuratus immune response, and provides further evidence that invertebrate immune systems are neither simple nor static.
Keywords
Background
Diversified immune responses provide hosts with advantages in the arms race against pathogens. Diversification of immune-response proteins enables organisms to detect and combat a broad array of pathogens with great precision. Although it was long believed that invertebrate organisms possessed simple, static immune systems, recent evidence from numerous organisms suggests that this may not be correct (reviewed in [1]). In the freshwater snail, Biomphalaria glabrata, a family of genes encodes fibrinogen-related proteins (FREPs), which contain IgSF and fibrinogen domains [2–9]. Although it is not known how many FREP genes are present in the snail genome, at least 13 subfamilies exist, with some predicted to contain as many as eight loci. These genes are expressed in response to trematode parasites and produce a large repertoire of mRNAs that encode a diverse set of proteins. It is believed that a limited set of source sequences is used to generate FREP diversity through point mutation and somatic recombination [6]. A comparably diverse gene family in amphioxus, Branchiostoma floridae, encodes V region-containing chitin-binding proteins (VCBP), which contain two Ig V-type domains [10]. Five subfamilies of VCBPs are known to exist based on sequence analysis. Higher plants also have large gene families that encode resistance (R) proteins. R gene diversity results from extensive recombination, mispairing, gene duplication, and gene conversion [11–13].
Analysis of the sea urchin genome revealed a number of large gene families putatively involved in the sea urchin immune response [14], in addition to the previously identified complement system [14–21]. The S. purpuratus genome contains 222 predicted gene models that encode Toll-like receptors (TLRs) and 203 that encode NOD/NALP-like receptors (NLRs) [14]. Both the TLR and NLR gene families are components of vertebrate innate immune systems, although with significantly fewer versions (there are 10 TLR and approximately 20 NLR genes in humans [14]). Although little is known about the functions of these receptor genes in the sea urchin, their diversity suggests that they can recognize a broad range of pathogenic signatures collectively or combinatorially [22]. An additional 218 gene models encoding scavenger receptor cysteine-rich receptors (SRCR) were predicted from the sea urchin genome [14]. Previous studies have shown that the expressed SRCR transcript repertoire is transient in unchallenged sea urchins and changes in response to injury or pathogenic challenge [23]. SRCRs are members of a metazoan superfamily with a variety of functions, including the regulation and development of vertebrate immune responses [24–26]. Thus, large gene families appear to be a common theme in the sea urchin immune response.
Additionally, a diverse set of transcripts called 185/333 is strongly upregulated in response to a variety of immunological challenges [27–30]. 185/333 sequences are of particular interest due to their diversity and expression patterns. Of 81 originally characterized 185/333 cDNA sequences, 67 had unique nucleotide sequences encoding 64 unique protein sequences [27]. Further analysis of expression patterns indicated that certain 185/333 sequences may be preferentially upregulated in response to particular pathogen-associated molecular patterns (PAMPs) [29]. Alignment of the transcripts required the insertion of large gaps, creating 25 blocks of sequence called elements, and an identifiable leader. The sequences also contained five types of repeats, the borders of which did not correspond to the element borders. Because individual 185/333 sequences included a variable subset of elements, their presence and absence were used to define element patterns. Specific patterns observed in numerous clones defined cDNA sets [27]. Although the mRNA structure strongly implied alternative splicing [27], two assembled 185/333 genes from an early assembly of the S. purpuratus genome indicated that, with the exception of the leader, all elements were located on a single exon [30]. Due to the substantial diversity of the mRNA and the unexpectedly simple gene structure, it was of interest to characterize the 185/333 gene family more closely.
The results presented here illustrate that the observed 185/333 transcript diversity is at least partially the result of a highly diverse family of genes present in the sea urchin genome. Previous studies suggest that there are about 100 different 185/333 alleles per sea urchin [30]. The diversity of 185/333 is illustrated by the fact that 71% of 171 cloned and sequenced genes were unique, and from these, 33 element patterns were identified, about half of which were newly described. From this and previous studies [27, 29, 30], a total of 51 element patterns are now known from 16 S. purpuratus individuals. We also show that the closely linked genes are flanked by short repeats, which may facilitate diversification through gene conversion, recombination, or meiotic mispairing. Overall the data show that the 185/333 gene family represents a new example of molecular diversity among invertebrate immune systems.
Results
The 185/333 genes are variable in size
Primers used in PCR and sequencing
Primer | Sequence (5' → 3') | Annealing site* |
---|---|---|
185-5'UTR | TAGCATCGGAGAGACCT | 5'UTR |
185-3'UTR | AAATTCTACACCTCGGCGAC | 3'UTR |
185-LR1 | ATCRTYGCCATYSTGGCYG | Leader |
185-F2 | AAGMGATTWCAATGAACKRCGAG | Ex1/Er1 |
185-F5 | GGAACYGARGAMGGATCTC | Ex25/Er27 |
185-F6 | GAAGAAGAAACTGATGCTGCC | Ex7/Er6 |
185-R5 | ACTCTGTACTGCGGAGAGCCGAC | Ex4/Er3, Ex5/Er4and Ex6/Er5 |
185-R6 | GCAGCATCAGTTTCTTCKTCTC | Ex7/Er6 |
185-R9 | CTTHARGTGGTGAARATGTCG | Ex25/Er27 |
185-R11 | ATCTCCCAGGCGTGATG | Ex25/Er27 |
Amplification of 185/333 sequences. A. gDNA from animal 2 was amplified by PCR using primers flanking the 185/333 genes (185-5'UTR and 185-3'UTR; see Table 1) and showed bands of five major sizes from 1.2 to 2 kb and a minor band around 4 kb. Triangles indicate the positions of each of the bands. Similar amplification of gDNA from six additional animals had identical patterns of bands (data not shown). B. Amplification of intergenic regions by PCR using primers that annealed within genes but were oriented away from each other (185-LR1 and 185-F5 primers; Table 1) revealed a major band in all animals of about 3 kb (lanes 1–4, animals 10–13). C. gDNA from animal 2 was amplified by PCR using primers that annealed in the 5' UTR (185-5' UTR; Table 1) and the type I repeats found in elements Ex4, Ex5, and Ex6 (185-R5; Table 1) and revealed the presence of genes that lacked introns. Animal 2 gDNA (lane 1) shows a band of 450 bp (indicated with a carrot). A cDNA (Sp0313, DQ183171; lane 2) also amplifies a band of about 450 bp. A cloned gene (2-02, Additional file 1; GenBank accession number EF607673; lane 3) with a typical intron amplifies a band within the range of bands in A. D. PCR amplification of 185/333 from eight different BAC clones using primers (185-5'UTR and 185-3'UTR; Table 1). Each lane contains template DNA from a different BAC (1, 126J14; 2, 108H07; 3, 053M03; 4, 121A07; 5, 004D19; 6, 182N21; 7, 148J22; 8, 019L13).
Elements and patterns
Elements
Exon 2 elements
cDNA-based Element patterns of the 185/333 genes. A. Exon element patterns. Gene sequences were manually aligned based on alignments of cDNA sequences. The insertion of gaps (black lines), which defined the 25 elements (shown as colored boxes) [30]. A consensus sequence containing all the elements and the locations of the two exons is shown at the top. The source of each gDNA is indicated by the colored dots in the columns labeled "Animal". Blue dots indicate that the pattern was isolated from animal 2, red dots from animal 4, and green dots from animal 10. The frequency with which the patterns were found is indicated in the column labeled "Freq". The element patterns are sorted into groups (grey background shading) based on the subtype of Ex15 (specified by the letter in the box). The locations of the five types of repeats [27,30] are shown at the bottom of A (red boxes indicate type 1 repeats; blue = type 2; green = type 3; yellow = type 4; and purple = type 5). Patterns not previously identified from cDNA analysis [27,30] are denoted with an asterisk (*). The position of the stop codon in element Ex25 is indicated by the letter present in the box and the size/shape of the box (Additional file 2, Additional file 3). There are 31 unique patterns based on both exon elements and intron type. B: Intronless genes with unique element patterns amplified from BAC DNA. Untranslated sequence (due to a missense deletion) is indicated by lighter shading and narrower boxes for E2.7. The locations of the repeats are the same as A.
The terminal element in both the cDNA [30] and gene sequences, Ex25, was characterized by stop codons in three locations, which divided Ex25 into three regions, Ex25a (138 nt), 25b (57 nt) and 25c (Additional file 2 and Additional file 3). The final stop codon, which defined element Ex25c, was not found in the gene sequences because the primer used for cloning (185-3'UTR; Table 1) was located in 25c just 5' of the third stop codon. Furthermore, there were three distinct subtypes of element Ex25b in the cDNA sequences based on the presence or absence of a series of gaps in one of two positions [30], all of which were also identified among the gene sequences (Additional file 2, Additional file 3).
The frequency with which each of the elements was present within the clones was relatively constant among the three animals studied (data not shown). The exceptions were pairs of mutually exclusive elements, of which one or the other was found in all clones analyzed. One such pair of elements was Ex10 and Ex12. In animal 2, 66% of clones had element 10 and 34% had Ex12, whereas in animal 4, 87% of clones had element 10 and 16% had Ex12. It is of note that Ex10 and Ex12 were 92% similar at the nucleotide level and therefore may encode regions of similar function in the protein.
Patterns
Exon element patterns
Suites of elements associated with Er10/Er15 subtypes
cDNA-based alignment | Repeat-based alignment | |||||
---|---|---|---|---|---|---|
Ex15/Er10 Subtype | Intron types | # Genes | # Exon Patterns | Elements Present* | # Exon Patterns | Elements Present+ |
a | γ | 2 | 1 | 5, 6, 10, 11, 14–16, 20–24 | 1 | 3, 4, 7, 9–16, 18–25 |
b | α,β,ε | 19 | 7 | 13–15, 19, 20 | 5 | 8–11, 14, 25 |
c | α | 6 | 3 | 10, 13–17, 22 | 3 | 8–11, 14, 16, 17, 21, 22 |
d | α,ε | 39 | 4 | 10, 13–20, | 2 | 8–11, 14, 16, 17, 21–25 |
e | α,γ,δ | 29 | 7 | 13–15, 19–20 | 4 | 8–11, 14, 25 |
f | β | 4 | 2 | 12–17, 19–20 | 1 | 8–11, 14, 16, 17, 21, 23–25 |
g | γ | 2 | 2 | 5, 6, 10, 11, 14–16, 20–22 | 2 | 3, 4, 7, 9–11 |
0 | α,ε,γ | 20 | 2 | 10, 18–22 | 1 | 22–25 |
Genes with Ex15a or Ex15g (element patterns A1, G2 and G3) had nearly identical combinations of elements (Table 2; Figure 2A). Ex15g and Ex15a may therefore represent population-level differences of a single Ex15 subtype rather than two distinct subtypes. This was supported by the fact that a) each subtype was isolated from an individual animal, b) element Ex15g was only a single amino acid longer than Ex15a and was otherwise identical in sequence, and c) the element patterns of these genes were very similar. However, a single clone (10-013; Additional file 1), with element pattern G3, contained most of the typical group A/G hallmarks, but lacked elements Ex23 and Ex24 (Figure 2A). Of the more than 810 gene and transcript sequences analyzed thus far [29, 30], Ex15a and Ex15g always occurred in association with Ex23, with the exception of G3. Furthermore, the sequence of the G3 clone was identical to the single G2 clone from the same animal, with the exception of the absence of Ex23 and Ex24 (Additional file 2). Therefore, the G3 type gene may have arisen as a result of a duplication of the G2 gene, followed by a deletion of elements Ex23 and 24.
Intron types
Phylogenetic tree of intron sequences. Intron sequences were aligned manually (Additional file 2). Maximum likelihood and maximum parsimony methods both produced unrooted tree shown. The five major clades were used to define the five intron types, as shown.
A total of 31 gene element patterns were defined by the combination of exon element patterns and intron types (Figure 2A; Figure 3), 12 of which formed gene sets composed of two or more unique genes with identical element patterns. Eight patterns were collected from more than one animal. Genes that formed sets were isolated from either a single animal (D5 ε was present only in animal 2), or from all three animals (E2 δ). The three patterns shared among all three animals, E2 δ, D1 α, and 01 δ display increased transcription after sea urchins are challenged with various PAMPs [29]. The most commonly observed transcript pattern, E2, was found 12 times among the genes, suggesting that its increased transcription may result from an increased number of genes.
Generally, exon element patterns correlated with intron type (Figure 2A). However, there were three instances in which genes with the same exon element patterns had different intron types. Exon element pattern 01 correlated with three different intron types, α, δ, or ε. Gene pattern 01 δ was identified in the majority of the 01 clones (17 of the 19 01 clones), whereas 01 α and 01 ε were isolated only once (Figure 2A). Exon element patterns E3 and B3 also had different intron types (E3 genes had either intron α or δ, whereas B3 genes had either introns α or β). Genes with identical intron element patterns also had different exon element patterns, such as C3 α and D1 α (Figure 2A; Figure 3). Therefore, although exon element patterns typically correlated with a single intron type, there were examples when they did not.
Diversity
As expected from previous analyses of the cDNA sequences [27, 29, 30], the 185/333 genes comprise an exceptionally diverse family. Identical gene sequences were not shared among the three sea urchins. Taq- induced polymorphisms and template switching were ruled out as sources of diversity (Additional file 5). To quantify the diversity, two approaches were employed: calculations of entropy-based diversity scores and ratios of synonymous to non-synonymous nucleotide substitutions [30]. Diversity scores were calculated as in [29, 30] using a formula based on the method of [31], and depend upon the frequency of the nucleotides or amino acids at each alignment position, but are independent of the sequence length or size of the data set. Although the maximum possible diversity score is 1.609, a more realistic biological maximum score might be similar that previously observed for element 11 from expressed cDNA sequences [30], or about 0.600. Diversity scores provide a means to identify variable regions, and can be used to compare the diversity of different elements or different sets of genes.
Nucleotide diversity of the elements
Exon Elements
Diversity of the 185/333 gene elements. Nucleotide diversity scores (black bars) and amino acid diversity scores (gray bars) of individual exon elements are shown. The average element nucleotide diversity is indicated by a dashed black line and average element amino acid diversity is shown as a dashed gray line. The absolute range of diversity scores is 0 (entirely conserved) to 1.609 for nucleotide alignments (based on an even distribution of five states: four nucleotides and a gap) or 3.044 for amino acid alignments (21 possible states) [30]. The highest element diversity score previously observed was from element 11 (0.5381) from a set of cDNAs isolated from bacterially-challenged coelomocytes pooled from five animals [30]. This score was similar to that obtained from a modeled element in which 40% of the positions contained four different states in 20% of the sequences. Elements with a diversity score of 0 were omitted (Ex11, Ex15a, Ex15c, and Ex15f-g of the cDNA-based alignment (A) and Er7, Er10a, Er10c, Er10f-g, Er12 -13, Er18, and Er20 of the repeat-based alignment (B). The number (#), length in nucleotides (L) and nucleotide to amino acid diversity ratio (R) are indicated in the table to the left of the graphs. Ex25 includes both Ex25a and Ex25b. Ex25a includes all sequences from the start of Ex25 up to and including the first stop codon. Ex25b includes only the sequence following the first stop codon to the second stop codon (Additional file 2 and Additional file 3). Element Er27 in the repeat-based alignment (B) is treated similarly.
The overall sequence diversity in the dataset stemmed from the interplay between four possible sources: a) SNPs present only in individual genes (unshared variations), b) the number of variable positions in an alignment, c) the number of states in each alignment position, and d) the number of unique sequences. Because diversity scores rely on the frequency of each state in each alignment position, changes that occur in a single sequence have minimal effects on the overall diversity. However, as the total number of sequences decreases, the impact of these variations on the overall diversity scores increases. The range of percent variable positions among the elements was 0 (Ex11) to 88.9% (Ex15). Ex15 had both the greatest percent of variable positions and the highest nucleotide diversity score. The average number of states per variable nucleotide position among the elements (excluding the conserved Ex11) was 2.1.
Diversity of the Intron and Exon+
Sequence | Length | Nt Diversity | # Unshared Variations (%)1 | % Variable Positions | # Unique Sequences |
---|---|---|---|---|---|
cDNA-based 2nd Exon | 1695 | 0.0522 | 93 (5.5) | 18.2 | 112 |
Intron | 446 | 0.1752* | 25 (5.6) | 40.1* | 52 |
Repeat-based 2nd Exon | 1449 | 0.0556 | 102 (7.0) | 21.3 | 112 |
Amino acid sequence diversity of the elements
The diversity of the amino acid sequences encoded by the exon elements was analyzed using the same approaches used to characterize nucleotide diversity. Overall, amino acid element diversity ranged from 0 to 0.4977 (Ex15; average = 0.1350 ± 0.1120; Figure 4A, gray bars), and generally correlated with nucleotide element diversity scores. The average number of unshared variations for the amino acid element sequences was 2.81, with a maximum of 24 in Ex7. On average, 38% of amino acid positions were variable, higher than the average number of variable nucleotide positions (26%), underscoring the high number of nonsynonymous substitutions within the data set. The average number of states per variable position over all elements was similar to that observed in the nucleotide alignments (2.2 for amino acids vs. 2.1 for nucleotides). The highest average number of states per variable position within an element was Ex21, which had 3. However, this number is low, given that the theoretical maximum number of states per position is 21 amino acids. Furthermore, the average number of unique amino acid sequences is lower than that in the nucleotide alignments (8.7 for amino acids vs. 11.2 for nucleotides). Therefore, although some of the diversity is masked in the encoded proteins by synonymous substitutions, if all of the genes are translated, much of the diversity would permeate through to generate a highly diverse pool of proteins.
Ratios of nucleotide and amino acid diversity scores
Ratios of the nucleotide vs. amino acid diversity scores (diversity ratios) provided insight into the relative levels of synonymous and non-synonymous substitutions among the elements [29, 30]. This approach was implemented because the elements were generally too short to determine dn/ds ratios using PAML [32]. If each nucleotide change resulted in an amino acid change, the ratio of amino acid diversity to nucleotide diversity would equal 3 because the number of variable positions and the diversity of those positions would remain constant, but the length of the nt vs. amino acid sequence would differ by a factor of 3 (3 nucleotides encode 1 amino acid). However, if all nucleotide changes were silent, the resulting amino acid diversity and diversity ratio would equal 0. Specifically, the diversity ratio indicates how many of the three variable positions in a codon result in non-synonymous changes. A high diversity ratio indicates primarily non-synonymous changes, and a low ratio indicates mostly synonymous changes. There was no correlation between diversity ratios and diversity scores.
The two elements with diversity ratios of less than 1 (fewer than one out of three nucleotide changes resulted in an amino acid change) were Ex19 (0.83) and Ex21 (0.60), suggesting that these elements had the greatest number of synonymous nucleotide substitutions (Figure 4A). Elements with ratios greater than 2.5 were Ex1, Ex8, Ex10, Ex22, Ex23, and Ex24 (Figure 4A). Ex8, Ex10, Ex23, and Ex24 exhibited artificially high ratios due to a low number of nucleotide changes, most of which encoded non-synonymous changes. For example, Ex23 had two non-synonymous nucleotide mutations that resulted in a ratio close to 3. Overall, 15 of the 25 elements were characterized by diversity ratios of at least 1.5 (Figure 4A), indicating that, on average for these elements, half of the nucleotide substitutions resulted in a nonsynonymous amino acid change. The amino acid diversity scores therefore illustrated that not only are the 185/333 genes diverse, but much of this diversity encodes changes to the amino acid sequence.
Diversity of the intron
The diversity of the intron sequences was measured using the same characteristics as those used to understand the diversity of the exon elements. To compare intron and exon diversity, diversity characteristics for the entire second exon were analyzed disregarding all gaps (including those that defined the elements). Therefore, the values for the second exon were lower than when the second exon was analyzed including gaps as a fifth state. The diversity of the intron was over 3 times higher than the second exon (Table 3). This elevated diversity resulted from a significant increase in the percent variable positions in the intron (with respect to the lengths of the entire alignments). Within the intron sequence, ~40% of the alignment positions were variable, as compared to only 18% in the second exon (Table 3).
Diversity of individual nucleotide positions
Diversity of nucleotide positions. A. Each bar represents the nucleotide diversity of a single nucleotide position within the alignment of all cloned 185/333 genes. Green bars represent nucleotide positions within the intron. Gaps due to missing elements were excluded from the diversity calculations. B. Hypervariable positions within the 185/333 genes were identified using diversity analysis on clones belonging to cDNA-based sets (Table 5) with more than two members (94 genes total). Because sets had variable numbers of members, which artificially increases diversity for positions in sets with fewer members, each diversity score greater than 0 was assigned a value of 1. Each bar in the graph represents the number of sets (out of 8 total) that contained a polymorphism at the specific nucleotide position. Green bars indicate positions within the intron. Bars below the x-axis denote the borders between elements (cDNA-based alignment).
The overall diversity for the entire 185/333 nucleotide alignment, including gaps as a fifth state, was 0.2692. Separating the sequences by source animal resulted in diversity scores of 0.2532 for the genes from animal 2, 0.2253 for the genes from animal 4, and 0.2856 for the genes from animal 10. If the gene sets were congruous and their combination did not produce any additional diversity, the diversity score for the entire set of genes would be equal to average of the scores from individual animals, weighted by the number of genes isolated from each animal. This weighted average was 0.2565, slightly lower than the observed value. This phenomenon of higher diversity for genes from all three animals combined was not limited to the results from the analysis of the entire alignment, but also to individual elements. For example, Ex5 was conserved within individual animals, but had a diversity score of 0.0185 when all three animals were combined. The increased diversity score for genes from the three animals combined indicated that gene sequences from a single animal were more conserved than the collection of genes across animals. These differences underscored not only the diversity of members of this gene family, but also the diversity of the 185/333 genes within the population.
Repeat-based alignment
Repeat-based alignment of the 185/333 genes. The alignment was optimized for repeats and 27 elements (colored boxes) were defined. Gaps due to missing elements are indicated by horizontal black lines. There are 17 different exon element patterns, which, when combined with the intron types (Figure 3), form a total of 21 unique gene patterns. The frequency (Freq) of patterns indicates how often the pattern was identified. The source animal for each pattern is indicated by the presence of a colored dot as in Figure 2. The subtype of element Er10 (which corresponds to Ex15, Figure 2A) is indicated by the letter in the box. Intron patterns are unaffected by this alignment because they do not have repeats; their designation corresponds to that shown in Figure 3.
Correlation of elements in the cDNA-based and repeat-based alignments. The elements of the cDNA-based and repeat-based alignments are shown as blocks. Lines connecting the blocks indicate the relative positions of elements in the two alignments. In elements ExL to Ex7 and ErL to Er6, the elements correlate closely between the two alignments. Only elements Ex1 and Ex2 of the cDNA-based alignment are merged to form Er1 in the repeat-based alignment. In the Ex8 to Ex25, however, the sequences are interdigitated to accommodate the alignment of the repeats, particularly those in Ex23.
Characteristics of the cDNA-based vs. repeat-based alignments
cDNA-based Alignment | Repeat-based Alignment | |
---|---|---|
2nd exon length (nt) | 1721 | 1524 |
Number of elements | 25 | 27 |
Average element Size (nt) | 68 | 56 |
Range of element Sizes (nt) | 12 – 357 | 11–192 |
Element Patterns (2nd exon) | 27 | 14 |
Element Patterns (intron + exons) | 31 | 21 |
Type 1 repeats (red*) | 4 | 4 |
Type 2 repeats (blue) | 4 | 4 |
Type 3 repeats (green) | 4 | 2 |
Type 4 repeats (yellow) | 4 | 3 |
Type 5 repeats (purple) | 3 | 2 |
Average set nt diversity | 0.0194 | 0.0216 |
Overall nt diversity | 0.3011 | 0.2779 |
Average element nt diversity | 0.0846 | 0.0629 |
Repeat-based alignment element patterns
The presence or absence of 27 elements from the second exon of the repeat-based alignment defined 14 unique patterns (Figure 6), fewer than the 27 patterns identified in the cDNA-based alignment (Figure 2A; Table 3). Element patterns from the repeat-based alignment have been designated with an r in front of the pattern name. Some gene sets were unaffected by the alignment changes (e.g., A1 became rA1). Other cDNA-based element patterns were merged to form repeat-based patterns; E2δ, E3 δ, and E7δ were combined in the repeat-based alignment to form gene set rE2/3/7 δ. The majority of repeat-based patterns were defined by the presence or absence of elements Er3, Er14, Er16, Er17, and Er21 through Er25 (Figure 6). The most common repeat-based pattern was rD1/6/7 (38 genes), whereas twelve patterns were defined by single genes. As in the cDNA-based alignment, genes containing either Er10a or Er10g were distinct from the rest of the dataset because they also had Er4, Er7, Er12–16, and Er18–27 (Table 2). Repeat-based element patterns largely correlated with intron type, with the same exceptions as those in the cDNA-based alignment (Figure 6).
Element diversity analysis
To understand how modifying the alignment affected sequence diversity, nucleotide and amino acid diversity scores were calculated for the repeat-based elements (Figure 4B) and the overall alignment. The overall alignment nucleotide sequence diversity and average element diversity for the repeat-based alignment were slightly lower than those of the cDNA-based alignment (Table 4). Due to the element subtypes, elements Er10 and Er27b had the highest nucleotide diversity (similar to Ex15 and Ex25; Figure 7). One explanation for the decreased average repeat-based element diversity score was an increased number of conserved elements: five in the repeat-based alignment, compared to one in the cDNA-based alignment (Figure 4).
Diversity of the gene sets
Characteristics of the gene sets in both the cDNA-based and the repeat-based alignment#
Set | Freq. | Length (nt) | Total nt div | ORF diversity | dn/ds | ||
---|---|---|---|---|---|---|---|
nt | aa | nt/aa ratio§ | |||||
01δ | 17 | 1246 | 0.0151 | 0.0168 | 0.0305 | 1.82 | 1.0699 |
r01/8δ^ | 18 | 1246 | 0.0151 | 0.0128 | 0.0267 | 2.09 | 1.0468 |
B3α/rB3α* | 5 | 1454 | 0.0178 | 0.0181 | 0.0198 | 1.09 | 0.6332 |
B3β | 9 | 1458 | 0.0243 | 0.0170 | 0.0248 | 1.46 | 0.6859 |
rB3/5β^ | 10 | 1459 | 0.0267 | 0.0222 | 0.0340 | 1.53 | 0.6776 |
C3/rC3α* | 4 | 1481 | 0.0104 | 0.0105 | 0.0161 | 1.53 | 0.5533 |
D1α | 35 | 1555 | 0.0191 | 0.0333 | 0.0485 | 1.46 | 1.1154 |
rD1/6/7α^ | 38 | 1555 | 0.0217 | 0.0347 | 0.0534 | 1.54 | 1.1558 |
E2δ | 12 | 1341 | 0.0411 | 0.0244 | 0.0420 | 1.72 | 0.8273 |
rE2/3/7/8/9δ^ | 26 | 1342 | 0.0466 | 0.0549 | 0.0766 | 1.40 | 0.7969 |
E3δ | 11 | 1339 | 0.0237 | 0.0148 | 0.0329 | 2.22 | 2.4132 |
F1β | 3 | 1440 | 0.0035 | 0.0044 | 0.0075 | 1.70 | 0.3826 |
rF1/2β^ | 4 | 1440 | 0.0129 | 0.0176 | 0.0280 | 1.59 | 0.6807 |
To understand the effect of nucleotide substitutions on the encoded protein sequence, gene sets from both alignments were subjected to two parallel lines of investigation: calculations of synonymous vs. non-synonymous (dn/ds) ratios [32], and ratios of nucleotide to amino acid diversity scores (Table 5). Of the 13 sets analyzed, five (01 δ, r01 δ/8, D1 α, rD1/6/7 α, and E3 δ) had dn/ds ratios greater than 1, indicating positive (diversifying) selection (shown in bold, Table 5). Two of these sets also had the highest diversity ratios (those with the most non-synonymous substitutions): E3 δ, and r01 δ/8. The set with least non-synonymous substitutions, B3 α/rB3 α, also had a low dn/ds ratio. There was not a strong correlation between the dn/ds values and the diversity ratios because PAML-based dn/ds analysis incorporates an amino acid similarity matrix, whereas the diversity ratios weight all amino acid substitutions equally. The average diversity ratio for the sets was 1.62, indicating that over half (1.62 of every 3) of the nucleotide substitutions resulted in a non-synonymous amino acid substitution. The average set diversity for the repeat-based alignment was slightly higher than that for the cDNA-based alignment (Table 4; Table 5), which may have been due to merging elements to generate the repeat-based alignment. Merging Ex10 and Ex12 increased the diversity score to 0.1197, compared to 0.0807 and 0.0766 when analyzed separately. Understanding the effects of nucleotide diversity on the encoded protein sequences provides some insight into the resulting pool of proteins.
Although it is unusual for a set of sequences to be aligned multiple ways with about equal characteristics, the repeats within the 185/333 sequences enabled this result. Each of the alignments defined different numbers of elements based on repeats and/or gaps within the sequences, and the presence or absence of those elements defined a series of patterns into which all of the genes could be classified. It was noteworthy that neither alignment proved significantly better at describing the diversity of the gene elements or sets. Due to the high levels of diversity found among the 185/333 sequences, it is likely that future analyses will uncover additional alignments that will refine our current understanding of these sequences.
BAC screening and intronless genes
A small BAC library constructed from S. purpuratus gDNA [33] was screened to identify clones containing 185/333 genes. In total, 48 BACs (of 92,160 in the library) were positive for 185/333 genes. Further analysis of these BACs by PCR using 185/333-specific primers (185-5'UTR and 185-3'UTR; Table 1) revealed that all 48 amplified at least one, and sometimes up to 10 bands (Figure 1D). We have assumed that each band represents one or more 185/333 genes in the BAC sequence, most of which were within the typical size range. However, some bands were notably smaller than expected (< 1 kb; Figure 1D). Cloning and sequencing of these bands revealed that these genes did not have an intron (Figure 2B; Additional file 8).
In total, 12 clones were sequenced from two BACs (091G11, n = 8; and 190D12, n = 4), of which five were unique, three contained introns (patterns D1 α, 01 δ, and B3 β) and two were intronless (Figure 2B). Two of the sequences were isolated from both BACs, suggesting that the BAC inserts overlap. The two intronless clones had exon patterns E2 (named E2x) and previously unidentified pattern, E2.7 δ (Figure 2B). E2.7 δ was unique because it had the same element pattern as E2 δ, but contained an 88 bp deletion spanning elements Ex2 through Ex3 (Er1 and Er2). This deletion did not correspond with a repeat or an intact element and introduced a frameshift that resulted in missense sequence and a stop codon 23 bp after the deletion. It was therefore possible that E2.7 was a pseudogene, perhaps the only one identified from 126 unique genes analyzed.
Additional evidence for the presence of intronless genes was acquired by amplifying genomic DNA using primers that annealed in the 5'UTR (185-5'UTR; Table 1) and in the type 1 repeats of elements Ex4, Ex5, and Ex6 (185-R5; Table 1). A fragment of ~450 bp was amplified from genomic DNA from animal 2, which was too short to include a typical 400 bp intron (Figure 1C, lane 1). This region was similar in size to that amplified from a cDNA clone, Sp0313 (DQ183171, [27]) using the same primers (Figure 1C, lane 2). The low frequency of intronless clones within the 185/333 gene family may account for our inability to detect smaller fragments when the entire genome was used as the template.
Gene locus structure
Structure of part of the 185/333 locus. Scaffold_v2_79421 from the S. purpuratus genome assembly (Version 2, June 15, 2006) contains four linked 185/333 genes (diagram not to scale). Each of the genes includes a single intron in the predicted location. The element patterns of the genes are based on the cDNA-based alignment are indicated. Pattern D8 was not isolated from the cloned genes; however, it is similar to pattern D1, but contains Ex12 rather than Ex10. The orientations of the genes are indicated by the arrows. Dinucleotide (GA; striped ovals) flank the genes and trinucleotide repeats (GAT; solid parallelograms) are present on the 5' side of the genes.
Discussion
Previous reports described the sequences and expression patterns of the 185/333 transcripts [27, 29, 30]. The data presented here detail the structure and diversity of the 185/333 genes and suggest that they compose a large family of linked genes within the S. purpuratus genome. The typical gene structure has two exons separated by a single intron, although genes lacking introns are also present in the genome. Based on repeats within the genes, multiple alignments of the 185/333 sequences are possible. The two alignments utilized in this study define elements based on large gaps employed for one of two reasons: to align the transcript sequences [27, 29, 30], or to optimize the repeats. The presence/absence of the elements defines element patterns (33 patterns in the cDNA-based alignment and 17 patterns in the repeat-based alignment). The high level of diversity of the genes is exemplified by the 121 distinct genes among the 171 that were cloned and sequenced. Diversity is distributed throughout the sequence, and varies among the elements. The 121 unique gene sequences encode 101 unique amino acid sequences, indicating that the genetic diversity extends to the encoded proteins. Half of the gene sets, composed of unique genes with identical element patterns, are under positive selection according to dn/ds analysis. The 185/333 genes (100 ± 20 alleles [30]) are typically spaced about 3 kb apart, and are flanked by short repeats. The 185/333 gene family is therefore composed of a suite of closely linked, highly diverse genes.
Gene diversity
Although initial reports of the 185/333 sequences suggested that their diversity may be the result of putative alternative splicing [27], the data presented here support the previous conclusion [30] that the element pattern diversity observed among the 185/333 transcripts is not the result of alternative splicing, but resides within the second exon. With one exception (element 11a), all of the elements found in the message sequences were also identified among the genes, and no new elements were found. Other than the single intron located directly after the leader sequence, no additional introns were identified. However, larger amplicons (~4 kb) were observed when genomic DNA was amplified with primers flanking the genes (Figure 1A). Although nothing is known about the sequence of these genes, there are three possible explanations for these fragments: (1) genes with duplications of currently known elements, or additional elements that are currently unknown; (2) genes in which the primer annealing sites were mutated or missing, causing the amplification to skip over genes; (3) genes with larger or more introns. Analysis of the 185/333 locus in which many of the genes reside will be required to understand the PCR results. However, based on the frequency of genes in which the second exon encodes the majority of the open reading frame, it is unlikely that alternative splicing is the primary mechanism to generate the diverse array of element patterns observed among the transcript sequences.
In a previous study [29], half of the expressed transcripts contained an early stop codon which, if translated, would encode missense or truncated proteins. It is curious that, given the frequency of these messages and the number of genes cloned and sequenced, with one exception (pattern E2.7), no early stop codons or frameshifts were found in any of the gene sequences. Element pattern E2.1, which has a SNP generated a stop codon in Ex10 and constitutes 65% of the 185/333 messages in coelomocytes prior to challenge and 33% of 185/333 messages after challenge with various antigens, was not found among the gene sequences, despite the fact that animals 2 and 4, from which E2.1 transcripts were isolated, were also the source of gDNA in this study. It is possible that an E2.1 gene is present within the genome of these two animals and was simply not cloned. Alternatively, the 185/333 messages may be post-transcriptionally modified through as yet unknown mechanisms that introduce SNPs into the transcripts, which cause frameshifts or early stop codons. This discord between gene and messages sequences from individual animals is a future area of investigation.
In addition to analyzing the diversity of the 185/333 gene sequences, it is also of interest to understand those aspects of the genes which are conserved. Element sequences are conserved in that there are very few variations found in single sequences, and each element has relatively few unique sequences. Because there are so few unshared variations, each exon element (L – Ex25) consists of, on average, 11 unique sequences. Given the 121 unique total gene sequences, this number is surprisingly low. Elements are commonly associated with one another, and element patterns are largely defined by element Ex15 (or Er10) subtypes, which are commonly associated with suites of elements [30]. Furthermore, diversity data on the sets suggests that genes with identical element patterns tend to have more similar nucleotide sequences. Perhaps genes commonly share suites of elements due to their relative proximity on the chromosome and frequent recombination. The genes may be arranged within the 185/333 locus in smaller gene subfamilies, according to Ex15 subtype or element pattern. Further sequencing and analysis of this locus will be required to confirm this hypothesis.
Intron diversity
On the whole, the intron sequences of the 185/333 gene family are more diverse than the exon sequences, primarily as a result of an increased average number of variable positions within the elements. This may be due to decreased selective pressure to maintain this non-coding sequence. Although diversity is present throughout the intron sequence, small conserved regions exist that may serve as transcription factor binding sites or regulatory sequences. Preliminary evidence suggests that there may be AP-1, dorsal and GATA binding sites within the intron (unpublished data), all of which have been shown to upregulate genes involved with immune functions [34–36]. Although most of the exon element patterns are associated with a specific intron type, there are examples when the two do not correlate. If the intron serves to regulate gene expression or has some other regulatory function, altering the intron type may affect the transcription of the exon element pattern.
Using three animals in this study provided preliminary insight into the population-level diversity of the 185/333 gene family. Among the 121 unique sequences isolated from the three animals, no identical gene sequence was shared among two or more animals. This diversity is also illustrated from the 872 sequences (both messages and genes) collected from 16 different animals that contain 477 unique open reading frames that form 51 exon element patterns and encode 323 unique protein sequences [29, 30]. The 14 new exon element patterns identified in this study may represent genes that are not commonly expressed, or genes that are not expressed in response to challenge with marine bacteria, lipopolysaccharide (LPS), double-stranded RNA (dsRNA), or β-1,3-glucan; [29, 30]). Although the function of the 185/333 proteins is unknown, the sequence diversity, size of the gene family, and expression patterns all suggest a role in the defense response of S. purpuratus. An immune-related function would help explain this high level of inter-animal diversity, because in the arms race against pathogens, it is important to maintain a polymorphic population of immune-related genes within the host to allow survival in the presence of new pathogens.
Compared to other sea urchin genes, the 185/333 genes are atypical. Among the 23,300 predicted gene models in the sea urchin genome, the average gene has 8.3 exons and spans 7.7 kb [37]. Furthermore, although the 185/333 intron is smaller than average (~400 bp compared to the average size of 750 bp), the second exon length is significantly longer (average exon length is 100–115 nt) [37]. It has been suggested that highly expressed genes are under selection to maintain short introns, due to the cost of transcribing and splicing long introns [38]. Although the 185/333 introns are not much shorter than average, in C. elegans, the difference in average intron length between highly expressed genes and those expressed at low levels was only 2-fold. At the extreme, histone genes, which are highly expressed in replicating cells lack introns altogether [39]. The 185/333 genes are strongly upregulated in response to bacterial challenge, and represent ~65% of the transcripts in immune activated coelomocytes [30]. This high level of expression may be the selective pressure for maintaining short intron sequences.
Locus structure
Analysis of the S. purpuratus genome assembly and genomic DNA by PCR amplification indicates that the 185/333 gene locus consists of tandem arrays of closely linked genes. Genomic DNA amplification using a variety of primers suggests that genes are oriented head to tail, head to head, and tail to tail (unpublished data). Given the high sequence similarity (>88% identical), among the genes and their close linkage, the several types of repeats located within the genes, and the small repeats located between the genes, each gene and its immediate flanking region might be considered as a large repeat. The sequences flanking the genes through the short repeat regions are moderately conserved, and that this conservation is lost beyond the dinucleotide repeats (unpublished data). Therefore, it is possible that the 185/333 genes are arranged as cassettes defined on either side by dinucleotide repeats, which may facilitate diversification events, such as meiotic mispairing, gene conversion, recombination, or duplication and/or deletion of intact genes with the cis promoter. Dinucleotide repeats have been associated with genomic instability, which increases population diversity [40] and recombination frequency [41]. Although dinucleotide repeats are also common in the S. purpuratus genome (preliminary estimates of about 49,000 in the genome [33]), nothing is known about the relative locations of repeats vs. open reading frames. The putative 185/333 gene locus structure therefore appears to be optimal for numerous diversification strategies as would be predicted for genes that encode proteins with important immune functions.
Conclusion
Analysis of the 185/333 gene family reveals that the diversity observed within the transcript repertoire is not the result of alternative splicing, but rather, is encoded within the second exon of the genes. These genes exhibit variability in both element patterns and sequence variations, and preliminary data indicates that they encode a diverse family of proteins (unpublished). The repeats within and surrounding the genes, as well as their close linkage create a locus that is optimal to promote diversification events such as recombination and/or gene conversion. Therefore, the 185/333 gene family represents an example of invertebrate innate immunity that is more complex than previously believed. These results add to the growing body of evidence suggesting that all organisms, including vertebrates, invertebrates, and plants maintain highly diverse innate immune systems, and that diversification may be driven by pathogen pressure.
Methods
Animals
Sea urchins were collected by Marinus Scientific, Inc. (Long Beach, CA) by SCUBA divers from near-shore, sub-tidal regions off the coast of southern California and were housed as previously described [17].
Genomic DNA isolation
Genomic DNA (gDNA) was isolated from coelomocytes collected from two sea urchins or from sperm from a single individual as previously described [30, 42].
BAC library screens and BAC plasmid isolation
Filters from an arrayed BAC library were screened for 185/333 positive clones using riboprobes. The library was constructed using the pBAC3.6 vector with insert sizes between 50 and 60 kb [33]. Three cDNA clones [Sp0032 (DQ183167), Sp0164 (DQ183149), and Sp0313 (DQ183171)], with element patterns A1, D1, and C1, respectively [27, 30] were selected to synthesize a mixture of riboprobes because they collectively contained all known elements. Riboprobes were generated by incorporating 32P-rUTP and filters were screened according to [43]. Positive clones were received from Eric Davidson and Andrew Cameron at the California Institute of Technology.
Overnight cultures of BAC clones were grown in 2xYT containing 12.5 μg/mL chloramphenicol. Cells were pelleted by centrifugation for 2 minutes at 12,500 × g and resuspended in 300 μL buffer P1 (15 mM Tris, pH = 8; 10 mM EDTA; 100 μg/mL RNAseA). Buffer P2 (300 μL; 0.2 N NaOH; 1% SDS), and buffer P3 (300 μL; 3 M potassium acetate, pH = 5) were added, and the mixture was kept on ice for 5 minutes. Samples were spun at 12,500 × g for 10 minutes at 4°C and the supernatants were precipitated by the addition of an equal volume of isopropanol and resuspended in Tris-EDTA (TE; 10 mM Tris, pH = 8; 1 mM EDTA).
Gene amplification, intergenic PCR, and cloning
The template for polymerase chain reaction (PCR) was either 100 ng of gDNA, 50 ng of BAC DNA, or 10 ng of a cloned gene. Genes cloned from animals 2 and 10 were amplified in PCR reactions consisting of 1 μM of each primer (Table 1), 150 μM of each deoxynucleotide, 2 mM MgCl2, and either 0.5 U Optimase DNA Polymerase (Transgenomic, Inc.) or 0.5 U Ex Taq DNA Polymerase (Takara Mirius Bio., Madison, WI) and 1X of the appropriate company-supplied buffer. Both amplifications used the following program: 94°C for 3 minutes followed by 25 cycles of 94°C for 30 seconds, 61°C for 30 seconds, and 72°C for 1 minute, with a final extension of 72°C for 5 minutes and a 4°C hold. Full-length genes were amplified by PCR using the primer pair 185-3'UTR and 185-5'UTR (Table 1). To analyze the 5' half of the cloned genes (leader through Ex7) and to identify those without introns, clones were amplified with primers 185-5'UTR and 185-R6 (Table 1).
To amplify intergenic regions from BAC or gDNA, reactions consisted of 400 nM each primer (LR1 and F5; Table 1), 400 μM of each deoxynucleotide, 2.5 mM MgCl2, 1X company supplied buffer (Takara Mirius Bio), and 0.5 U Takara LA Taq (Takara Mirius Bio). The amplification program was: 94°C for 2 minutes followed by 25 cycles of 94°C for 20 seconds, and 61°C for 9 minutes, with a final extension of 72°C for 10 minutes and a 4°C hold.
Amplified 185/333 genes were cloned into the pCR4-TOPO vector using the Topo-TA Cloning Kit for Sequencing according to the manufacturer (Invitrogen, Carlsbad, CA). Plasmid DNA was isolated using the Wizard Plus Miniprep DNA Purification System (Promega, Madison, WI). Gene sequences were submitted to Genbank with accession numbers EF607618–EF607793.
Cycle sequencing
DNA sequencing was done using the GenomeLab Dye Terminator Cycle Sequencing with Quick Start Kit according to the manufacturer (Beckman Coulter, Fullerton, CA) and analyzed on a Beckman CEQ 8000 DNA sequencer (Beckman Coulter).
Bioinformatics
Sequences were manually aligned using Bioedit [44]. PERL scripts were written to identify identical sequences and to calculate diversity characteristics (Additional files 9, 10, 11, 12). Sequence diversity was calculated as in [30]. Nonsynonymous/synonymous (dn/ds) ratios were calculated using Phylogenetic Analysis by Maximum Likelihood (PAML) [32]. Neighbor-joining trees for PAML were created using unique sequences with Molecular Evolutionary Genetics Analysis (MEGA), v. 3.1 [45]. Phylogenetic analysis of the intron was done using Phylip [46]. Maximum likelihood and maximum parsimony trees were generated, and bootstrap values were determined based on 500 replications.
Declarations
Acknowledgements
The authors would like to thank Dr. David Raftos for helpful improvements to the manuscript and helpful discussions. Dr. Tom Kepler provided valuable discussions regarding the alignments. Trudy Gillevet assisted with cloning and sequencing the intronless genes from the BACs. Gavin Riordan assisted with the sequencing, and the sequencing controls. Rebecca Easley provided valuable PCR assistance. Lindsay Edwards assisted with the Genbank submissions. The research was supported by funding from the National Science Foundation (MCB-0424235) to LCS.
Authors’ Affiliations
References
- Flajnik MF, Du Pasquier L: Evolution of innate and adaptive immunity: can we draw a line? Trends Immunol 2004,25(12):640-644. 10.1016/j.it.2004.10.001View ArticlePubMedGoogle Scholar
- Adema CM, Hertel LA, Miller RD, Loker ES: A family of fibrinogen-related proteins that precipitates parasite-derived molecules is produced by an invertebrate after infection. Proc Natl Acad Sci U S A 1997,94(16):8691-8696. 10.1073/pnas.94.16.8691PubMed CentralView ArticlePubMedGoogle Scholar
- Hertel LA, Adema CM, Loker ES: Differential expression of FREP genes in two strains of Biomphalaria glabrata following exposure to the digenetic trematodes Schistosoma mansoni and Echinostoma paraensei. Dev Comp Immunol 2005,29(4):295-303. 10.1016/j.dci.2004.08.003View ArticlePubMedGoogle Scholar
- Leonard PM, Adema CM, Zhang SM, Loker ES: Structure of two FREP genes that combine IgSF and fibrinogen domains, with comments on diversity of the FREP gene family in the snail Biomphalaria glabrata. Gene 2001,269(1-2):155-165. 10.1016/S0378-1119(01)00444-9View ArticlePubMedGoogle Scholar
- Litman GW, Cannon JP, Rast JP: New insights into alternative mechanisms of immune receptor diversification. Adv Immunol 2005, 87: 209-236. 10.1016/S0065-2776(05)87006-3View ArticlePubMedGoogle Scholar
- Zhang SM, Adema CM, Kepler TB, Loker ES: Diversification of Ig superfamily genes in an invertebrate. Science 2004,305(5681):251-254. 10.1126/science.1088069View ArticlePubMedGoogle Scholar
- Zhang SM, Leonard PM, Adema CM, Loker ES: Parasite-responsive IgSF members in the snail Biomphalaria glabrata: characterization of novel genes with tandemly arranged IgSF domains and a fibrinogen domain. Immunogenetics 2001,53(8):684-694. 10.1007/s00251-001-0386-8View ArticlePubMedGoogle Scholar
- Zhang SM, Loker ES: The FREP gene family in the snail Biomphalaria glabrata: additional members, and evidence consistent with alternative splicing and FREP retrosequences. Fibrinogen-related proteins. Dev Comp Immunol 2003,27(3):175-187. 10.1016/S0145-305X(02)00091-5View ArticlePubMedGoogle Scholar
- Zhang SM, Loker ES: Representation of an immune responsive gene family encoding fibrinogen-related proteins in the freshwater mollusc Biomphalaria glabrata, an intermediate host for Schistosoma mansoni. Gene 2004, 341: 255-266. 10.1016/j.gene.2004.07.003PubMed CentralView ArticlePubMedGoogle Scholar
- Cannon JP, Haire RN, Litman GW: Identification of diversified genes that contain immunoglobulin-like variable regions in a protochordate. Nat Immunol 2002,3(12):1200-1207. 10.1038/ni849View ArticlePubMedGoogle Scholar
- Hulbert SH, Webb CA, Smith SM, Sun Q: Resistance gene complexes: evolution and utilization. Annu Rev Phytopathol 2001, 39: 285-312. 10.1146/annurev.phyto.39.1.285View ArticlePubMedGoogle Scholar
- Parniske M, Hammond-Kosack KE, Golstein C, Thomas CM, Jones DA, Harrison K, Wulff BB, Jones JD: Novel disease resistance specificities result from sequence exchange between tandemly repeated genes at the Cf-4/9 locus of tomato. Cell 1997,91(6):821-832. 10.1016/S0092-8674(00)80470-5View ArticlePubMedGoogle Scholar
- Parniske M, Jones JD: Recombination between diverged clusters of the tomato Cf-9 plant disease resistance gene family. Proc Natl Acad Sci U S A 1999,96(10):5850-5855. 10.1073/pnas.96.10.5850PubMed CentralView ArticlePubMedGoogle Scholar
- Hibino T, Coll ML, Messier C, Majeske AC D.P. Terwilliger, K.M. Buckley, V. Brockton, S. Nair, K. Berney, S.D. Fugmann, M.K. Anderson, Z. Pancer, R.A. Cameron, L.C. Smith, J.P. Rast.: The immune gene repertoire encoded in the purple sea urchin genome. Developmental Biology 2006.Google Scholar
- Clow LA, Gross PS, Shih CS, Smith LC: Expression of SpC3, the sea urchin complement component, in response to lipopolysaccharide. Immunogenetics 2000,51(12):1021-1033. 10.1007/s002510000233View ArticlePubMedGoogle Scholar
- Clow LA, Raftos DA, Gross PS, Smith LC: The sea urchin complement homologue, SpC3, functions as an opsonin. J Exp Biol 2004,207(Pt 12):2147-2155. 10.1242/jeb.01001View ArticlePubMedGoogle Scholar
- Gross PS, Clow LA, Smith LC: SpC3, the complement homologue from the purple sea urchin, Strongylocentrotus purpuratus, is expressed in two subpopulations of the phagocytic coelomocytes. Immunogenetics 2000,51(12):1034-1044. 10.1007/s002510000234View ArticlePubMedGoogle Scholar
- Smith LC: Thioester function is conserved in SpC3, the sea urchin homologue of the complement component C3. Dev Comp Immunol 2002,26(7):603-614. 10.1016/S0145-305X(02)00017-4View ArticlePubMedGoogle Scholar
- Smith LC, Britten RJ, Davidson EH: A Homolog to Complement C3 (or C4) Is Expressed in Sea-Urchin Coelomocytes. Faseb Journal 1995,9(3):A490-A490.Google Scholar
- Smith LC, Shih CS, Dachenhausen SG: Coelomocytes express SpBf, a homologue of factor B, the second component in the sea urchin complement system. J Immunol 1998,161(12):6784-6793.PubMedGoogle Scholar
- Terwilliger DP, Clow LA, Gross PS, Smith LC: Constitutive expression and alternative splicing of the exons encoding SCRs in Sp152, the sea urchin homologue of complement factor B. Implications on the evolution of the Bf/C2 gene family. Immunogenetics 2004,56(7):531-543. 10.1007/s00251-004-0711-0View ArticlePubMedGoogle Scholar
- Rast JP, Smith LC, Loiza-Coll M, Hibino T, Litman GW: The sea urchin genome sequence provides a new perspective on animal immunity. Science 2006.Google Scholar
- Pancer Z: Dynamic expression of multiple scavenger receptor cysteine-rich genes in coelomocytes of the purple sea urchin. Proc Natl Acad Sci U S A 2000,97(24):13156-13161. 10.1073/pnas.230096397PubMed CentralView ArticlePubMedGoogle Scholar
- Resnick D, Pearson A, Krieger M: The SRCR superfamily: a family reminiscent of the Ig superfamily. Trends Biochem Sci 1994,19(1):5-8. 10.1016/0968-0004(94)90165-1View ArticlePubMedGoogle Scholar
- Aruffo A, Bowen MA, Patel DD, Haynes BF, Starling GC, Gebe JA, Bajorath J: CD6-ligand interactions: a paradigm for SRCR domain function? Immunol Today 1997,18(10):498-504. 10.1016/S0167-5699(97)01130-4View ArticlePubMedGoogle Scholar
- O'Keeffe MA, Metcalfe SA, Cunningham CP, Walker ID: Sheep CD4(+) alphabeta T cells express novel members of the T19 multigene family. Immunogenetics 1999,49(1):45-55. 10.1007/s002510050462View ArticlePubMedGoogle Scholar
- Nair SV, Del Valle H, Gross PS, Terwilliger DP, Smith LC: Macroarray analysis of coelomocyte gene expression in response to LPS in the sea urchin. Identification of unexpected immune diversity in an invertebrate. Physiol Genomics 2005,22(1):33-47. 10.1152/physiolgenomics.00052.2005View ArticlePubMedGoogle Scholar
- Rast JP, Pancer Z, Davidson EH: New approaches towards an understanding of deuterostome immunity. Curr Top Microbiol Immunol 2000, 248: 3-16.PubMedGoogle Scholar
- Terwilliger DP, Buckley KM, Brockton V, Ritter NJ, Smith LC: Distinctive expression patterns of 185/333 genes in the purple sea urchin, Strongylocentrotus purpuratus: An unexpectedly diverse family of transcripts in response to LPS, beta-1,3-glucan, and dsRNA. BMC Mol Biol 2007, 8: 16. 10.1186/1471-2199-8-16PubMed CentralView ArticlePubMedGoogle Scholar
- Terwilliger DP, Buckley KM, Mehta D, Moorjani PG, Smith LC: Unexpected diversity displayed in cDNAs expressed by the immune cells of the purple sea urchin, Strongylocentrotus purpuratus. Physiological Genomics 2006,26(2):134-144. 10.1152/physiolgenomics.00011.2006View ArticlePubMedGoogle Scholar
- Durbin R, Eddy S, Krogh A, Mitchison G: Biological sequence analysis, probability models of proteins and nucleic acids. Cambridge, UK , Cambridge University Press; 1998.View ArticleGoogle Scholar
- Yang Z: PAML: a program package for phylogenetic analysis by maximum likelihood. Comput Appl Biosci 1997,13(5):555-556.PubMedGoogle Scholar
- Cameron RA, Mahairas G, Rast JP, Martinez P, Biondi TR, Swartzell S, Wallace JC, Poustka AJ, Livingston BT, Wray GA, Ettensohn CA, Lehrach H, Britten RJ, Davidson EH, Hood L: A sea urchin genome project: sequence scan, virtual map, and additional resources. Proc Natl Acad Sci U S A 2000,97(17):9514-9518. 10.1073/pnas.160261897PubMed CentralView ArticlePubMedGoogle Scholar
- Han ZS, Enslen H, Hu X, Meng X, Wu IH, Barrett T, Davis RJ, Ip YT: A conserved p38 mitogen-activated protein kinase pathway regulates Drosophila immunity gene expression. Mol Cell Biol 1998,18(6):3527-3539.PubMed CentralView ArticlePubMedGoogle Scholar
- Matova N, Anderson KV: Rel/NF-kappaB double mutants reveal that cellular immunity is central to Drosophila host defense. Proc Natl Acad Sci U S A 2006,103(44):16424-16429. 10.1073/pnas.0605721103PubMed CentralView ArticlePubMedGoogle Scholar
- Senger K, Harris K, Levine M: GATA factors participate in tissue-specific immune responses in Drosophila larvae. Proc Natl Acad Sci U S A 2006,103(43):15957-15962. 10.1073/pnas.0607608103PubMed CentralView ArticlePubMedGoogle Scholar
- Sodergren E, Weinstock GM, Davidson EH, Cameron RA, Gibbs RA, Angerer RC, Angerer LM, Arnone MI, Burgess DR, Burke RD, Coffman JA, Dean M, Elphick MR, Ettensohn CA, Foltz KR, Hamdoun A, Hynes RO, Klein WH, Marzluff W, McClay DR, Morris RL, Mushegian A, Rast JP, Smith LC, Thorndyke MC, Vacquier VD, Wessel GM, Wray G, Zhang L, Elsik CG, Ermolaeva O, Hlavina W, Hofmann G, Kitts P, Landrum MJ, Mackey AJ, Maglott D, Panopoulou G, Poustka AJ, Pruitt K, Sapojnikov V, Song X, Souvorov A, Solovyev V, Wei Z, Whittaker CA, Worley K, Durbin KJ, Shen Y, Fedrigo O, Garfield D, Haygood R, Primus A, Satija R, Severson T, Gonzalez-Garay ML, Jackson AR, Milosavljevic A, Tong M, Killian CE, Livingston BT, Wilt FH, Adams N, Belle R, Carbonneau S, Cheung R, Cormier P, Cosson B, Croce J, Fernandez-Guerra A, Geneviere AM, Goel M, Kelkar H, Morales J, Mulner-Lorillon O, Robertson AJ, Goldstone JV, Cole B, Epel D, Gold B, Hahn ME, Howard-Ashby M, Scally M, Stegeman JJ, Allgood EL, Cool J, Judkins KM, McCafferty SS, Musante AM, Obar RA, Rawson AP, Rossetti BJ, Gibbons IR, Hoffman MP, Leone A, Istrail S, Materna SC, Samanta MP, Stolc V, Tongprasit W, Tu Q, Bergeron KF, Brandhorst BP, Whittle J, Berney K, Bottjer DJ, Calestani C, Peterson K, Chow E, Yuan QA, Elhaik E, Graur D, Reese JT, Bosdet I, Heesun S, Marra MA, Schein J, Anderson MK, Brockton V, Buckley KM, Cohen AH, Fugmann SD, Hibino T, Loza-Coll M, Majeske AJ, Messier C, Nair SV, Pancer Z, Terwilliger DP, Agca C, Arboleda E, Chen N, Churcher AM, Hallbook F, Humphrey GW, Idris MM, Kiyama T, Liang S, Mellott D, Mu X, Murray G, Olinski RP, Raible F, Rowe M, Taylor JS, Tessmar-Raible K, Wang D, Wilson KH, Yaguchi S, Gaasterland T, Galindo BE, Gunaratne HJ, Juliano C, Kinukawa M, Moy GW, Neill AT, Nomura M, Raisch M, Reade A, Roux MM, Song JL, Su YH, Townley IK, Voronina E, Wong JL, Amore G, Branno M, Brown ER, Cavalieri V, Duboc V, Duloquin L, Flytzanis C, Gache C, Lapraz F, Lepage T, Locascio A, Martinez P, Matassi G, Matranga V, Range R, Rizzo F, Rottinger E, Beane W, Bradham C, Byrum C, Glenn T, Hussain S, Manning G, Miranda E, Thomason R, Walton K, Wikramanayke A, Wu SY, Xu R, Brown CT, Chen L, Gray RF, Lee PY, Nam J, Oliveri P, Smith J, Muzny D, Bell S, Chacko J, Cree A, Curry S, Davis C, Dinh H, Dugan-Rocha S, Fowler J, Gill R, Hamilton C, Hernandez J, Hines S, Hume J, Jackson L, Jolivet A, Kovar C, Lee S, Lewis L, Miner G, Morgan M, Nazareth LV, Okwuonu G, Parker D, Pu LL, Thorn R, Wright R: The genome of the sea urchin Strongylocentrotus purpuratus. Science 2006,314(5801):941-952. 10.1126/science.1133609View ArticlePubMedGoogle Scholar
- Castillo-Davis CI, Mekhedov SL, Hartl DL, Koonin EV, Kondrashov FA: Selection for short introns in highly expressed genes. Nat Genet 2002,31(4):415-418.PubMedGoogle Scholar
- Marzluff WF, Sakallah S, Kelkar H: The sea urchin histone gene complement. Dev Biol 2006,300(1):308-320. 10.1016/j.ydbio.2006.08.067View ArticlePubMedGoogle Scholar
- Rogaev EI: Simple human DNA-repeats associated with genomic hypervariability, flanking the genomic retroposons and similar to retroviral sites. Nucleic Acids Res 1990,18(7):1879-1885. 10.1093/nar/18.7.1879PubMed CentralView ArticlePubMedGoogle Scholar
- Majewski J, Ott J: GT repeats are associated with recombination on human chromosome 22. Genome Res 2000,10(8):1108-1114. 10.1101/gr.10.8.1108PubMed CentralView ArticlePubMedGoogle Scholar
- Lee JJ, Shott RJ, Rose SJ 3rd, Thomas TL, Britten RJ, Davidson EH: Sea urchin actin gene subtypes. Gene number, linkage and evolution. J Mol Biol 1984,172(2):149-176. 10.1016/S0022-2836(84)80035-2View ArticlePubMedGoogle Scholar
- Multerer KA, Smith LC: Two cDNAs from the purple sea urchin, Strongylocentrotus purpuratus, encoding mosaic proteins with domains found in factor H, factor I, and complement components C6 and C7. Immunogenetics 2004,56(2):89-106. 10.1007/s00251-004-0665-2View ArticlePubMedGoogle Scholar
- Hall TA: BioEdit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 1999, 41: 95-98.Google Scholar
- Kumar S, Tamura K, Nei M: MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 2004,5(2):150-163. 10.1093/bib/5.2.150View ArticlePubMedGoogle Scholar
- Felsenstein J: PHYLIP (Phylogeny Inference Package) version 3.6. Distributed by the author. Department of Genome Sciences, University of Washington, Seattle. 2005.Google Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.