Efficient transfer of RNAi-inducing cassettes using lentiviral vectors

Lentiviral vectors were generated which deliver an expression cassette for human U6 promoter-driven expression of short hairpin RNA (shRNA), with exact homology to the human PAI-2 mRNA. The vector expression cassette also bears the enhanced green fluorescent protein (GFP) gene under the control of the EF-1α promoter, and an internal ribosome entry site (IRES) sequence (see Figure 1A). This cassette allows permanent expression of GFP in transduced cells, and the possibility of concomitant overexpression of a further cDNA, between the EF-1α promoter and IRES sequences, not used here. The shRNA sequences were chosen from the PAI-2 mRNA to include a 5' guanosine at the U6 promoter transcriptional start site, to exclude the 5' and 3' 100 nucleotides of the PAI-2 open reading frame, and to be between 30 and 70 % guanosine/cytidine rich. As controls, we have used a vector leading to expression of GFP alone (EGFP), a vector with the U6 promoter and transcriptional termination signals but lacking a hairpin encoding sequence (U6PT), and vectors leading to expression of scrambled sequences of certain hairpins. Figure 1 demonstrates the efficient transduction of Isreco-1 (IS-1) human colorectal carcinoma cells with one such PAI-2 targeting vector (sh325). Sh325 is designed for expression of a shRNA with a 25 nucleotide double-stranded stretch (a 25 mer) to target the PAI-2 mRNA. As controls, we used U6PT and a scrambled sequence (sh325scr) vector. Four days after transduction, each cell population expressed high levels of GFP, as a marker for transduction (Figure 1B). Compared to non-transduced cells, or cells transduced with the U6PT control vector, we measured a clear knock-down of endogenous PAI-2 protein and mRNA in cells transduced with the sh325 vector (see figure 1C and 1D).

However, the control vector with a scrambled sequence (sh325scr) also reduced PAI-2 mRNA and protein levels. Equal sample loading for immunoblots was confirmed by Ponceau S staining of nitrocellulose membranes (data not shown) and the presence of equal amounts of a PAI-2 monoclonal antibody-reactive non-specific band in each blot (NS in Figure 1C).

Rapid cytotoxic effect of RNAi vectors

Many of the initial loss-of-function studies using RNAi have measured the phenotypic effect of gene silencing in the immediate time frame after introduction of the siRNA or RNAi-inducing expression vector. As seen in Figure 1, four days after transduction with our vectors appears to be sufficient for efficient target gene silencing. Transduction with lentiviral vectors leads to stable long-term integration of the desired transgene cassette, a key advantage in their use compared to other transient or less stable expression systems. Thus we reasoned that transduction with RNAi-inducing cassettes, using lentiviral vectors, would also be stable unless the reduction in target gene expression gave transduced cells a significant growth disadvantage or cytotoxic phenotype. Four to five days after transduction, IS-1 cells bearing the sh325 construct or cells transduced with a scrambled sh325 sequence rapidly changed morphology, compared to U6PT-transduced control cells. Sh325-transduced cells began to disintegrate into small particles and detach from cell culture dishes. After 10 days most of the sh325-transduced cells were dead while the U6PT-transduced cells were growing like the parent cell line. The scrambled hairpin vector-transduced cells gave a weaker cytotoxic phenotype, with deteriorating cell morphology and some detachment of transduced cells. Figure 2A shows the morphology of IS-1 cells 6 days after transduction. To understand further this cytotoxic effect, we performed quantitative RT-PCR (QRT-PCR) on RNA isolated from IS-1 cells, 4 days after transduction with the same vectors, in order to measure the levels of the 2'5'-oligoadenylate synthetase-1 (OAS1) mRNA after transduction with each vector. The OAS1 gene is recognised as an interferon response gene and has also been monitored elsewhere when using RNAi [21]. We measured increases in OAS1 expression in both sh325 and scrambled sh325 vector-transduced cells, whereas control-transduced cells (U6PT) had equal OAS1 levels to non-transduced cells (see Figure 2B).

19 mer shRNAs induce less cytotoxicity than longer hairpins and do not increase OAS1 expression

As both the target gene-specific and the scrambled sequence 25 mer shRNAs, sh325 and sh325scr, induced the OAS1 interferon response gene, we generated further vectors for delivery of shRNAs with reduced hairpin length. We reduced the length of sh325, from 25 to 23, 21 and 19 nucleotides and named the novel vectors sh323, sh321 and sh319, respectively. The truncations were made at the 3' end of the 25 nucleotide sense strand and therefore the 5' of its complementary anti-sense sequence (see Table 1). Each vector was used to transduce IS-1 cells and the growth of GFP positive cells monitored at 4 and 10 days after transduction, compared to U6PT control-transduced cells (see Figure 3A). Targeting of the PAI-2 mRNA and protein was monitored, four days after transduction, by QRT-PCR and immunoblotting of cell lysates (Figure 3B and 3C). While each PAI-2 targeted vector successfully reduced PAI-2 mRNA and protein four days after transduction, a strong negative selection was seen for shRNA-expressing cells after a further six days of culture. This selective pressure on transduced cells was stronger with the 21 mer, 23 mer and 25 mer shRNAs than with the shorter sh319-derived 19 mer (Figure 3A). OAS1 mRNA levels were measured by QRT-PCR of transduced cell cDNA four days after transduction (Figure 3B). The cells transduced with the 21 mer, 23 mer and 25 mer shRNAs showed induction of OAS1 mRNA, however, contrary to our expectations, highest OAS1 levels were obtained with the 21 mer shRNA. Loss of GFP positive cells over time was comparable for 21 mer, 23 mer and 25 mer hairpin constructs.

To determine whether the lack of OAS1 induction was specific to sh319 or common to other 19 mer shRNAs, further transductions and QRT-PCR analysis were performed on mRNA from IS-1 cells transduced with sh319, sh321 and sh319scr vectors. sh319scr encodes a shRNA with a scrambled sh319 sequence. This analysis also confirms the specificity of the PAI-2 silencing, by comparing sh319 to sh319scr. Figure 3D shows that no induction of OAS1 was measured using sh319 or sh319scr vectors and sh319scr had no effect on the PAI-2 mRNA level.

	Hairpin sequence
Name	sense	loop	antisense	Comments
sh319	GCGCACACCUGUACAGAUG	CAAGCUUC	CAUCUGUACAGGUGUGCGC	PAI-2 684–702
sh321	GCGCACACCUGUACAGAUGAU	CAAGCUUC	AUCAUCUGUACAGGUGUGCGC	PAI-2 684–704
sh323	GCGCACACCUGUACAGAUGAUGU	CAAGCUUC	ACAUCAUCUGUACAGGUGUGCGC	PAI-2 684–706
sh325	GCGCACACCUGUACAGAUGAUGUAC	CAAGCUUC	GUACAUCAUCUGUACAGGUGUGCGC	PAI-2 684–708
sh319scr	GUCAUACCGGCAAGGAUCC	CAAGCUUC	GGAUCCUUGCCGGUAUGAC	scrambled sh319
sh325scr	GGCCGGAGAUAAGUUCACUCAACUC	CAAGCUUC	GAGUUGAGUGAACUUAUCUCCGGCC	scrambled sh325
sh119	GAAGACCAGAUGGCCAAGG	CAAGCUUC	CCUUGGCCAUCUGGUCUUC	PAI-2 151–169
EGFP	No hairpin, empty vector.			none
U6PT	Human U6 promoter/terminator, no hairpin.			none

Cytotoxicity is not target gene specific

To determine if all or part of the cytotoxic effect seen with our shRNAs was due to down-regulation of PAI-2, we generated an IS-1 cell line which overexpresses functional PAI-2. A lentiviral vector was produced which delivers the wild type PAI-2 cDNA, and used to transduce IS-1 cells. This resulted in a homogeneous population of cells which overexpress PAI-2 (see Figure 4A, IS-1 PAI-2 cells). Using immunoblotting of PAI-2/u-PA complexes, formed by mixing IS-1 PAI-2 cell lysates with low molecular weight u-PA, we demonstrated that this overexpressed protein was functional (see Figure 4B). We transduced these cells with the series of shRNA-delivering vectors described in Figure 3 (sh325, sh323, sh321 and sh319), to test whether functional PAI-2 overexpression could reverse the cytotoxic phenotype. As even endogenous PAI-2 is not completely silenced using these vectors we reasoned that the RNAi they deliver would not be capable of functionally silencing overexpressed PAI-2. As predicted, our PAI-2 targeting shRNAs were unable to completely reduce the overexpressed PAI-2 protein levels (see Figure 4C, compared to the relative non-specific band intensity in Figure 3C). However, the cytotoxic effect seen with the parent IS-1 cell line was also clearly apparent in the PAI-2 overexpressing cells. We monitored the loss of GFP positive cells in the transduced PAI-2 overexpressing cell populations and saw almost identical kinetics, compared to the parent cell line (compare Figure 3A and Figure 4D). These data show that the cytotoxic effect is not target gene specific. We also measured the level of PAI-2 mRNA in this experiment, by QRT-PCR. Despite a several-fold decrease in overexpressed PAI-2 protein level (see immunoblot in Figure 4C) we were unable to detect knock-down of the overexpressed mRNA (Figure 4E). In a similar manner to the IS-1 parent cell line, transduction of PAI-2 overexpressing cells with sh325, sh323, sh321, but not the sh319 vector, induced the OAS1 interferon response gene (Figure 4F). To exclude IS-1 cell-specific effects of our vectors we transduced IS-1 cells and HeLa cells with a GFP control, the sh319 and the sh319 scrambled sequence (sh319scr) vectors. We monitored the percentage of GFP positive cells at day 4, 8 and 11 after transduction and observed similar selective loss of GFP positive cells for the sh319 and sh319scr vectors, in both cell lines (Table 2).

Reducing lentiviral vector titre can reduce shRNA expression level and OAS1 induction, while maintaining gene silencing

To understand whether lentiviral vector titre and resulting shRNA expression levels influence the non-specific effects described, IS-1 cells were transduced with the U6PT, sh319 and sh321 vectors as described above and also using a 10-fold reduction in vector titre (vector titre details are given in the figure 5 legend). Both sh319 and sh321 vectors effectively down-regulate PAI-2, but only the sh321 vector induces OAS1 expression (see Figure 3B). Using 10-fold lower vector titre had little impact on PAI-2 mRNA silencing, as seen using QRT-PCR (Figure 5A), and resulted in a small decrease in OAS1 mRNA induction (Figure 5B) in sh321-transduced cells. To assess whether lower vector titre resulted in lower shRNA expression, total RNA from cells transduced with different titres of sh321 vector was subjected to RNase digestion after hybridization with a ³²-P labelled RNA probe, designed to protect the first 19 nucleotides of the sh325 shRNA. Upon hybridization, this "sh3" probe should protect short RNA expressed in sh321 vector-transduced cells from RNase digestion. As negative controls, RNA from U6PT-transduced cells was subjected to the RNase protection procedure, and the sh3 probe was treated with RNase without target RNA. As a positive control a probe for the Mir-16 miRNA was constructed and used to detect endogenous Mir-16 miRNA in U6PT-transduced cells using the same protocol (Figure 5C). Sh3 probe-protected RNA was detected in sh321-transduced cells. Reducing the viral titre clearly reduced the expression of shRNA and this correlated with reduced OAS1 induction. Sh3 probe-protected RNA was not detected in control-transduced cells and the sh3 probe was completely digested in the absence of target RNA (Figure 5C). This data demonstrates that vector-derived shRNA expression can be reduced without impacting gene silencing and that lower expression correlates with a reduced interferon response.

Loss of long-term gene silencing despite persistent transduction marker gene expression

In an attempt to generate a cell line with stable PAI-2 mRNA silencing without interferon response induction, we generated additional vectors which deliver 19 to 25 nucleotide shRNAs targeting different regions of the PAI-2 mRNA. Of these, the sh119 construct reduced PAI-2 expression, did not induce OAS1 and had no effect on cell morphology one week after transduction (data not shown). In parallel, we transduced IS-1 cells with the sh119 vector or a GFP control vector. We achieved high percentage transduction rates which were monitored for over two weeks (Figure 6A). GFP positive cells, from control- and sh119-transduced populations were sorted twice, using flow cytometry, to further enrich the GFP positive population of each (EGFPs and sh119s). Sh119-transduced cells showed PAI-2 gene silencing 10 days after transduction but not after one month of cell culture (Figure 6B and 6C). GFP marker gene expression was maintained in both sorted cell populations. During the prolonged culture period we noticed that, while the percentage of GFP positive cells remained stable, the intensity of GFP detected was reduced in the sh119-transduced cells, compared to GFP alone controls (Figure 6A). This was accompanied by a significant reduction in integrated vector copies (data not shown). Thus, although the marker protein was maintained at a reduced expression level, the prolonged culture period selected against cells with effective gene silencing. This suggests the presence of subtle cytotoxic effects of short dsRNA expression which are not apparent in the initial post transduction period and are in the absence of interferon response gene induction. Overexpression of PAI-2 in the IS-1 cells did not reduce the long-term selective effect on transduced cells or GFP expression levels in sh119-transduced cells (see Table 3).

Cell lines

Isreco-1 (IS-1) cells were a gift from Dr. B. Sordat (ISREC, Lausanne). 293T cells were a gift from Dr. D. Trono (Geneva University Medical Centre). HeLa cells were purchased from the European collection of cell cultures, ECACC number: 93021013. All cells were maintained in DMEM supplemented with 10 % Fetal Bovine Serum and 10 mM HEPES pH 7.4 (IS-1 medium) (purchased from Invitrogen).

Plasmid constructions

Gene transfer plasmids, for RNA interference using lentiviral vectors, were constructed using the backbone of ploxEWiresGFP, a gift from Dr. P. Salmon, Geneva University Medical Centre. The human U6 gene was amplified by PCR using HeLa cell genomic DNA as template and the oligonucleotides U6-ClaI-F 5' GATC ATCGATAAGGTCGGGCAGGAAGAGGGCCTATTTCCC 3' and U6-ClaI-R 5' GATCATCGATTGGTAAACCGTGCACCGGCGATAAACG 3'. The 483 base pair PCR product was digested with ClaI, inserted into the ClaI site of pTRE2 hyg (Clontech), and its sequence verified by DNA sequencing. The U6 promoter and gene sequence corresponded to nucleotides 65 to 527 of Genbank accession number M14486. This plasmid was used as template for PCR reactions to amplify U6 promoter-driven expression cassettes. Each PCR product included the U6 promoter with shRNA-encoding sequences beginning at the U6 +1 site, and a run of 6 or 7 thymidine bases for an RNA polymerase III transcription termination signal. Each PCR introduced flanking ClaI restriction sites. PCR products were directly cloned into the pGEM Teasy (Promega) plasmid and sequenced. ClaI fragments of positive clones were excised and ligated into the unique ClaI site of ploxEWiresGFP. The U6 promoter cassettes in the resulting lentiviral vector plasmids were verified by DNA sequencing. Each construct used for vector production had the same orientation of the U6 expression cassette with respect to the P EF-1α-iresGFP region of the plasmid. A schematic of the gene transfer cassette is given in Figure 1A. Details of shRNA sequences used for each construct are given in Table 1. The gene transfer plasmid for PAI-2 overexpression was constructed by replacing the EGFP gene from ploxCW-GFP (a gift from Dr. P. Salmon, Geneva University Medical Centre) with the type B human PAI-2 (SERPINB2) [29] open reading frame.

Vector production and transduction

Lentiviral vectors were produced by three plasmid co-transfection of 293T cells, essentially as described previously [30]. Vectors were harvested 48 hours after transfection, passed through 0.45 μm filters and used directly on target cells in a 1:1 ratio with IS-1 medium in a total volume of 2 ml. Transductions were performed in 3 cm diameter 6-well plates, on cells seeded the previous day at 5 × 10⁴ or 1 × 10⁵ cells/well. Upon addition of vectors, plates were centrifuged for one hour at 1000 g in the presence of 8 μg/ml polybrene (hexadimethrine bromide, Sigma). After 24 hours, target cells were washed twice with PBS and cultured in IS-1 medium until analysis. Where indicated, viral titre was determined by transducing cells with 10 μl of lentiviral vector conditioned medium from 293T cell producer cells and measuring the % of GFP positive cells by flow cytometry. We routinely achieve 10⁶ effective transducing units per ml of producer cell conditioned medium, which results in a typical multiplicity of transduction of 10. Comparisons between cell populations transduced with different vectors is made by flow cytometry analysis of GFP positive cells.

Antibodies

Anti-human PAI-2 monoclonal antibody 3750 was purchased from American Diagnostica. PE-labelled goat anti-mouse antibodies were purchased from Pharmingen. HRP-conjugated goat anti-mouse antibodies were purchased from Bio-Rad.

Flow cytometry

Flow cytometry was performed using Becton Dickinson FACScan, FACStrack or FACScalibur instruments at the Geneva University Medical Centre flow cytometry facility. GFP was detected in cells detached and resuspended in FACS buffer comprising 1 % BSA in PBS supplemented with 0.05 % sodium azide. For the detection of intracellular PAI-2, a method adopted from Dr. M. Ranson (University of Wollongong, Australia) was used. Cells were detached and fixed in 0.25 % paraformaldehyde (PAF)/PBS for one hour on ice. Cells were permeabilised in 0.1 % saponin/PBS for 30 minutes at room temperature. Fixed, permeabilised cells were incubated for 30 minutes in PBS/0.5 % BSA/0.1 % saponin containing 2 μg/ml 3750 anti-PAI-2 monoclonal antibody, washed twice in PBS/0.1 % saponin and incubated for 30 minutes in 0.1 % saponin/0.5 % BSA/PBS/goat anti-mouse-PE antibodies. Finally, cells were washed twice in 0.1% saponin/PBS, twice in PBS and resuspended in 2.5 % PAF for flow cytometric analysis.

Sorting of live GFP positive cells was performed using a FACStar+ instrument (Becton Dickinson).

Western blotting of cell lysates

Cells in suspension were lysed in 10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 0.5 % NP-40, 3 mM MgCl₂, 5 mM DTT and 1 mM PMSF for one hour on ice. Lysates were centrifuged at 16000 g for 5–10 minutes to remove nuclei and precipitates. Supernatant protein concentrations were measured using the Bio-Rad protein assay with BSA in lysis buffer as a standard. Cell lysates were separated by reducing SDS-PAGE and transferred to nitrocellulose membranes. Equal total protein lysate was used for each blot, between 2.5 and 10 μg depending on the assay. Membranes were blocked for 1 hour at room temperature in TBS-0.1 % Tween 20/5 % non-fat milk, and probed using antibodies in TBS-0.1 % Tween 20/5 % non-fat milk. The 3750 anti-PAI-2 antibody was used at a concentration of 1 μg/ml.

Microscopy

Phase contrast microscopy was performed using a Zeiss Axiovert 100 M instrument on live cells. Images were collected using a Hamamatsu CCD camera (ORCA-100).

PAI-2 functional activity

To measure PAI-2 functional activity, IS-1 and IS-1 PAI-2 cells were lysed in 1 % NP-40, 150 mM NaCl and 50 mM Tris pH 8.0. Thereafter, 6 μg of cleared total cell lysate was incubated with and without 10 U of low molecular weight urokinase (u-PA). 3 μg total cell lysate samples were then subjected to reducing SDS-PAGE and immunoblotting as for other PAI-2 immunoblots.

Quantitative RT-PCR analysis of mRNA

Total RNA was isolated from cells using RNA preparation kits from Qiagen or TRIZOL^® reagent (Invitrogen). cDNA was generated using ImpromII^® reverse transcriptase (Promega) and random hexamers, according to the manufacturers instructions, typically using 1 μg of total RNA per reaction. Quantitative PCR was performed using an Applied Biosystems Prism 7000 instrument using Applied Biosystems SYBR^® green master mix reagent and oligonucleotide pairs to detect hypoxanthine phosphoribosyl transferase (HPRT), PAI-2 and oligoadenylate synthase-1 (OAS1) cDNA. 5' to 3' primer sequences were as follows: HPRT forward TATTGTAATGACCAGTCAACAG, HPRT reverse GGTCCTTTTCACCA GCAAG, PAI-2 forward GGGTCAAGACTCAAACCAAAG, PAI-2 reverse CCTTTGAAGTAGACAGCATTC, OAS1 forward AGGTGGTAAAGGGT GGCTCC and OAS1 reverse ACAACCAGGTCAGCGTCAGAT. Data were analysed using Applied Biosystems Prism software and the ΔC_T method. Briefly, target gene expression was normalised to the HPRT endogenous reference gene for each sample. The difference between mean threshold PCR cycle values for target and control genes gave the ΔC_T value. This was then calibrated to the control sample in each experiment to give the ΔΔC_T value, where the control had a ΔΔC_T value of 0. The fold target gene expression, compared to the calibrator value, is given by the formula 2^-ΔΔCT. Error bars represent the standard deviation of each target gene value, after evaluating the expression 2^-ΔΔCT+s and 2^-ΔΔCT-s, where s is the standard deviation of the ΔΔC_T value. All reactions were performed in duplicates or triplicates.

ShRNA detection

Expression of shRNAs was detected using the mir Vana™ Probe Construction and miRNA Detection kits from Ambion (Austin), according to the manufacturers instructions. These kits employ in vitro transcription for radiolabelled probe generation and an RNase protection protocol for detection of small RNA expression, respectively. Briefly, radiolabelled RNA probes incorporating α-³²P-UTP (Amersham) were constructed using T7 polymerase-driven transcription templates. Templates were designed to generate RNAs which hybridize to the endogenous Mir-16 miRNA, as a control, or the first 19 nucleotides of the sh325 shRNA (see table 1). The sh3 probe should therefore hybridize to any of the sh319/sh321/sh323 or sh325-derived shRNAs. Before hybridization, radiolabelled probes were purified by migration of the transcription reaction on a 12 or 15% Acrylamide/8 M Urea denaturing gel and elution of radioactive probe bands after detection by autoradiography. 3 μg of total cellular RNA was used for all hybridizations and RNase protections, supplemented with 2 μg yeast RNA as a carrier. Control reactions without target RNA but with or without RNase digestion included 5 μg yeast RNA. After hybridization and RNase digestion, protected probes were detected by autoradiography after migration in a 15% acrylamide/8 M Urea denaturing gel.