- Research article
- Open Access
Nuclear factor I-A represses expression of the cell adhesion molecule L1
https://doi.org/10.1186/1471-2199-10-107
© Schneegans et al; licensee BioMed Central Ltd. 2009
- Received: 24 July 2009
- Accepted: 14 December 2009
- Published: 14 December 2009
Abstract
Background
The neural cell adhesion molecule L1 plays a crucial role in development and plasticity of the nervous system. Neural cells thus require precise control of L1 expression.
Results
We identified a full binding site for nuclear factor I (NFI) transcription factors in the regulatory region of the mouse L1 gene. Electrophoretic mobility shift assay (EMSA) showed binding of nuclear factor I-A (NFI-A) to this site. Moreover, for a brain-specific isoform of NFI-A (NFI-A bs), we confirmed the interaction in vivo using chromatin immunoprecipitation (ChIP). Reporter gene assays showed that in neuroblastoma cells, overexpression of NFI-A bs repressed L1 expression threefold.
Conclusion
Our findings suggest that NFI-A, in particular its brain-specific isoform, represses L1 gene expression, and might act as a second silencer of L1 in addition to the neural restrictive silencer factor (NRSF).
Keywords
- Chinese Hamster Ovary Cell
- Electrophoretic Mobility Shift Assay
- Reporter Gene Assay
- Clone 12CA5
- Neural Restrictive Silencer Factor
Background
Neural adhesion molecules of the immunoglobulin superfamily mediate cell-cell recognition by homo- or heterophilic Ca2+-independent cell surface interactions [1]. L1, a member of this family, promotes neurite outgrowth and fasciculation, and is involved in axonal pathfinding, neuronal migration, regeneration and synaptic plasticity [1, 2]. Targeted ablation of L1 in mice leads to hydrocephalus, corpus callosum hypoplasia, and malformation of the corticospinal tract resembling mutations in the human L1 gene that result in an X-linked recessive neurological disorder called X-linked hydrocephalus, MASA syndrome or spastic paraplegia type I (SPG1) (reviewed by [1]). These observations in mice and man point to a key role of L1 in development of the nervous system.
In the control region of the mouse L1 gene, a neural restrictive silencer element (NRSE) was identified which is responsible for the neuronal expression of L1 during embryonic development and serves as a tissue-specific silencer and enhancer in postnatal animals [3, 4]. Moreover, the transcription factors Pax-6, Hoxa-1, and Barx2 bind to the murine L1 gene regulatory region, and Pax-6 activates mouse L1 gene expression [5, 6]. More recent studies have identified two additional activators of L1 transcription, LEF-1/TCF in human colorectal cancer cells [7], and KLF7 in olfactory sensory neurons [8]. Nuclear factor I-A (NFI-A), a member of the nuclear factor I (NFI) family of site-specific transcription factors, is a good candidate for controlling L1 transcription, as it regulates the expression of several neural proteins and thereby governs development of the central nervous system in mice and men (reviewed by [9, 10]). In the present study, we tested whether NFI-A binds to the murine L1 gene regulatory region and influences L1 gene expression.
Methods
Plasmid constructs
The L1 reporter plasmid L1-11 [3], a kind gift from Dr. P. Kallunki (H. Lundbeck A/S, Valby, Denmark), contains 2943 bp upstream of exon 1 of the mouse L1 gene, exon 1, intron 1, exon 2 with the luciferase cDNA inserted to replace the L1 start codon by the luciferase start codon, intron 2 including the neural restrictive silencer element, exon 3, intron 3 and exon 4. The NFI-A expression plasmid pCHNFI-A has been described previously [11] and expresses the hemagglutinin (HA) epitope-tagged [12] murine ortholog of chicken NFI-A1.1 [13], which, in this paper, is called "standard isoform" due to its widespread expression in various tissues of adult mice [11]. To express the brain-specific isoform of mouse NFI-A [14] in an HA epitope-tagged form, pCHBNFI-A was used, which was constructed analogously to pCHNFI-A. A plasmid which expresses brain-specific NFI-A lacking most of the activation domain (pCHBNFI-Am) was created by digesting the parental vector with Bst XI and Kpn I. 3' overhangs were removed by incubation with Platinum Pfx DNA Polymerase (Invitrogen, Karlsruhe, Germany) at 68°C for 15 min, and the resulting blunt ends were ligated using the Rapid DNA Ligation Kit (Roche, Mannheim, Germany). For ChIP experiments, Myc-tagged expression constructs for the standard and brain-specific NFI-A isoforms were made by cutting out the HA tag with Not I and Sfi I from pCHNFI-A and pCHBNFI-A, respectively. Two oligonucleotides, NFI-Myc 1 (GGCCGCTATGGAACAAAAACTCATCTCAGAAGAGGATCTGCAC) and NFI-Myc 2 (CAGATCCTCTTCTGAGATGAGTTTTTGTTCCATAGC) (Metabion, Martinsried, Germany), which contain the coding sequence of the Myc epitope combined with Kozak box, start codon and the compatible nucleotide overhangs, were annealed. The resulting double-stranded oligonucleotide was added to a 5-10 fold excess of the respective Not I/Sfi I-digested NFI-A expression vector, and ligated using the Rapid DNA Ligation Kit.
The CMX expression plasmid coding for β-galactosidase [15] was kindly provided by Dr. R. M. Evans (Salk Institute, La Jolla, CA, USA).
Cell culture
Mouse neuroblastoma cells (N2A) were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf serum, 1 mM sodium pyruvate, 2 mM L-glutamine, and antibiotics (100 units/ml penicillin and 100 μg/ml streptomycin). For reporter gene assays, N2A cells were grown in Opti-MEM without phenol red (Invitrogen, Karlsruhe. Germany) supplemented with 5% fetal calf serum, 200 units/ml of penicillin G, and 200 μg/ml streptomycin. Chinese hamster ovary cells (CHO) were grown in Glasgow minimum essential medium (GMEM), which contained 10% fetal calf serum, 4 mM L-glutamine, and antibiotics (100 units/ml penicillin and 100 μg/ml streptomycin). All cell types were grown at 37°C under a 5% CO2 atmosphere.
Electrophoretic mobility shift assays (EMSAs)
For EMSAs, HA-NFI-A constructs were expressed in CHO cells. Cells were plated onto 90-mm dishes in CHO culture medium. After reaching confluence, cells were washed once with CHO culture medium without serum and antibiotics. Transfections were performed with Lipofectamine (Invitrogen) according to the manufacturer's instructions. Per dish, 13 μg of the respective plasmid were transfected with 26 μl Lipofectamine and 39 μl Plus Reagent (Invitrogen). Three h later, the transfection reaction was stopped by addition of 6.5 ml CHO culture medium. 24 h after transfection, cell monolayers were washed once with PBS and harvested by scraping into PBS supplemented with Complete protease inhibitor (Roche). Cells were pelleted by spinning for 10 min at 4°C (300 × g), the supernatant was removed and the pellet resuspended in low salt lysis buffer (20 mM HEPES pH 7.8, 100 mM NaCl, 5 mM DTT, 1 × Complete protease inhibitor (Roche)). The cell suspension underwent three freeze-thaw cycles in dry ice/ethanol. Cell debris were removed by centrifugation (15 min, 4°C, 15000 × g), and the supernatant was used for DNA binding analysis. The electrophoretic mobility shift experiments were essentially performed as described [16]. In brief, single-stranded oligonucleotides were purchased (Metabion) and annealed, yielding double-stranded oligonucleotides with 5' overhangs. Double-stranded oligonucleotides were labeled with α-32P-dCTP using Klenow polymerase (Roche). Binding reactions were performed in a total volume of 10 μl consisting of 20 mM HEPES pH 7.8, 100 mM NaCl, 2 mM MgCl2, 7 mM DTT, 0.5 μg Cot-1 DNA, and 3 μl of cell lysate. Complete protease inhibitor was added according to the manufacturer's specifications (Roche). Binding reactions were incubated for 20 min followed by the addition of 2 μl of the labeled oligonucleotides, and incubated further for 20 min at room temperature. For the supershift, 1 μl of undiluted anti-HA (clone 12CA5, Roche) was added before loading, and incubated for another 20 min. In the case of competition experiments, radioactively labeled oligonucleotides were mixed with a 5-100 fold molar excess of the respective unlabeled oligonucleotides before being added to the binding reaction. Complexes were resolved by nondenaturing PAGE, and dried gels were exposed to BioMax MR film (Kodak, Stuttgart, Germany).
Oligonucleotides used were as follows: L, 5'-gctatTTGGCTTGGTGCCAAgcatc-3'; Lc, 5'-gctatTTC GCTTGGTGCCAAgcatc-3'; N, 5'-aggtCTGGCTTTGGGCCAAgagccgc-3'; Nc, aggtCTC GCTTTGGGCCAAgagccgc-3'; SIS, 5'-agcttaccagaaggtcaaggtcaaatgaagctagct-3' Sequences corresponding to the NFI binding site are capitalized; mutations in the negative control oligonucleotides are shown in boldface. The sequence of one strand is shown after the fill-in reaction.
Western Blot
In order to check HA-NFI-A expression by Western Blot, transfection of CHO cells was performed as described for EMSAs. However, 6-well plates were used, with DNA amounts and volumes of media and reagents adjusted accordingly. 24 h after transfection, cells were lysed by incubating in Ripa buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.5% (w/v) NP-40, 1 × Complete protease inhibitor (Roche)) for 1 h at 4°C. Cell debris were removed by centrifugation (15000 × g, 4°C, 10 min). The supernatant was mixed with sample buffer and boiled for 5 min. Proteins were separated by SDS-PAGE, transferred to a nitrocellulose membrane, and immunologically detected as described (Kalus et al. 2003). Anti-HA (from mouse, clone 12CA5, Roche) was used as primary antibody (1:400 in 4% milk powder in Tris-HCl-buffered saline (pH 7.3)). Horseradish peroxidase-conjugated goat anti-mouse secondary antibody (Dianova, Hamburg, Germany) was applied at a 1:10,000 dilution in 4% milk powder in Tris-HCl-buffered saline (pH 7.3). Detection of Myc-NFI-A st and Myc-NFI-A bs expression in N2A cells was performed following the same protocol, using anti-Myc (from mouse, clone 9E10, Santa Cruz, Heidelberg, Germany) as a primary antibody. Transfection of the respective plasmids was performed as described under "Chromatin immunoprecipitation assay". However, 6-well plates were used, with DNA amounts and volumes of media and reagents adjusted accordingly. To check for the amount of protein loaded per lane, an anti-GAPDH antibody was applied (anti-GAPDH from rabbit, Cell Signalling, mAb 14C10, 1:1000; followed by anti-rabbit-IgG-HRP, 1:20,000).
Chromatin immunoprecipitation assay (ChIP)
Myc-tagged NFI-A expression for ChIPs was carried out in N2A cells, cultivated on 90-mm dishes until confluency. 13 μg of the respective plasmid were transfected with 26 μl Lipofectamine and 39 μl Plus Reagent (Invitrogen) per dish according to the manufacturer's instructions. 48 h later, ChIP analysis was essentially performed as described [17]. For reduction of non-specific background, 0.5 μg anti-HA was applied per precipitation. Specific precipitation was achieved using anti-Myc. DNA fragments were purified with the MinElute PCR purification kit (Qiagen, Hilden, Germany). Subsequent PCR was carried out with the primers ChIP fw, GGAGTTCAAATGCCTTAACATGA, and ChIP rev, CTGGATGCCCTCAATAAATTCAT. For negative control amplifications of remote gene loci, the following primers were used: Chst11 fw, TGGAGACAGCCCTCCATAGATGT; Chst11 rev, GATGGCAGTGTTGGATAGCTCCA; Chst8 fw, GTAAACGACTTCTCCTACCGCA; Chst8 rev, GTATTGTCACAGGGACGATGTCCA. Amplification comprised 25 cycles, with the annealing temperature set to 55°C. As a positive control, genomic DNA from C57BL/6J mouse tail cuts was used, which was prepared according to the following protocol: tail cuts were incubated over night at 55°C in 100 μl lysis buffer (0.1 mg/ml proteinase K (Sigma, Taufkirchen, Germany); 50 mM Tris pH 8.0; 50 mM KCl; 2.5 mM EDTA; 0.45% NP-40 and 0.45% Tween-20). The next day, tissue debris were spun down, and the whole supernatant was extracted with an equal volume of PCI (phenol-chloroform-isoamyl alcohol, Biochrom, Berlin, Germany). DNA was precipitated with 2.5 volumes of ethanol and 0.1 volumes of 8 M LiCl. The pellet was washed with 70% ethanol and, after drying, resuspended in 50-100 μl 1 mM Tris pH 8.0.
Luciferase-based reporter gene assays
For transient transfections, 1 × 104 mouse neuroblastoma (N2A) cells were seeded in 96-well tissue culture plates (Greiner, Frickenhausen, Germany) and transfected the next day with 2.5 μl Lipofectamine 2000 (Invitrogen) per microgram of DNA. 80 ng reporter plasmid (L1-11), 60 ng of the effector plasmids (pCHBNFI-A or pCHBNFI-Am) or control CMX plasmid coding for β-galactosidase were applied per well. EGFP fluorescence generated by cotransfection of 60 ng pEGFP-C3 (Clontech, Heidelberg, Germany) was determined after 48 hours with a Wallac 1420 Multilabel Counter (PerkinElmer, Wiesbaden, Germany). Luciferase activity was measured with the Bright-Glo Luciferase Assay System according to the manufacturer's instructions (Promega, Mannheim, Germany). Light emission was normalized to the level of EGFP fluorescence activity from the EGFP control plasmid. Transfections were generally performed in septuplicate. Average relative luciferase light units and standard deviations were calculated using the Prism-4 program (GraphPad Software, La Jolla, CA, USA).
Results
Identification of a full NFI binding site in the first intron of the mouse L1 gene
The regulatory region of the mouse L1 gene contains a full NFI binding site. A, 15-nucleotide sequence (boldface) fully matching the NFI consensus binding motif [9]. Numbering with respect to the first nucleotide of exon 1 according to the mouse L1 gene nucleotide sequence deposited in GenBank (accession number NC_000086.6); sequences corresponding to the primers for ChIP analysis are underlined. B, The first four exons of the mouse L1 gene are indicated by boxes labeled E1-E4. Arrows: transcription initiation sites; ATG: translation start; filled circle: full NFI binding site; triangle: homeodomain and Pax protein binding site (HPD).
NFI-A binds to the regulatory region of the mouse L1 gene in vitro
Expression of HA-tagged NFI-A isoforms in CHO cells. A, Schematic drawing of the brain-specific isoform ("NFI-A bs") and the ubiquitous "standard" isoform ("NFI-A st") of mouse NFI-A. The isoform-specific N-termini (open rectangles) are encoded by exons 1a and 1b, respectively, and result from alternative splicing. Amino acid sequences encoded by these exons are given above and below. The major part of the protein (filled rectangles; not drawn to scale) is identical in both isoforms. Total length: 532 amino acids (NFI-A bs); 509 amino acids (NFI-A st). B, CHO cells were transfected with 2 μg of NFI-A cDNA expression vectors. Lane 1, pCHNFI-A ("standard" isoform); lane 2, pCHBNFI-A (brain-specific isoform); lane 3, mock transfected. Whole cell extracts were analyzed on an 8% SDS-PAGE gel, transferred to nitrocellulose membrane, and probed with anti-HA antibody. Filled arrows indicate bands which correspond to the respective HA-tagged NFI-A polypeptides, the open arrow shows a nonspecific band.
NFI-A binds to its full binding site in the mouse L1 gene in vitro. 32P-labeled oligonucleotides used for EMSA: L: full NFI binding site in mouse L1 gene with flanking sequences; Lc: point-mutated variant of L; N: idealized NFI binding site with flanking sequences [18]; Nc: point-mutated variant of N; C: oligonucleotide without NFI recognition motif (SIS oligonucleotide). NFI binding site sequences are capitalized, point mutations are shown in boldface. The sequence of one strand is shown after the fill-in reaction. Oligonucleotides were incubated with extracts from CHO cells expressing NFI-A bs or NFI-A st, or from mock-transfected cells (CMV). Only the upper and lower parts of the autoradiogram are shown, the middle section, which did not exhibit any signals, was cut out for reasons of space. Arrows A: HA-NFI-A-DNA complexes; arrow B: complexes of endogenous NFI and DNA; arrows C and D: free oligonucleotide DNA. Note that that the free SIS oligonucleotide migrates slightly slower (arrow C) than the other free oligonucleotides (arrow D) due to its higher molecular weight.
In vitro binding of NFI-A to its full binding site in the mouse L1 gene is confirmed by supershift and competition assays. EMSAs were performed with 32P-labeled oligonucleotides indicated above the autoradiograms (for a description, see Fig. 3). In both images (A-B), only the upper and lower parts of the respective autoradiogram are shown, the middle sections, which did not exhibit any signals, were cut out for reasons of space. A, Supershift experiment. NFI-A st "+": oligonucleotides were incubated with extracts from CHO cells transfected with pCHNFI-A (NFI-A st); NFI-A st "-": oligonucleotides were not pre-incubated with cell extracts (negative control). Where indicated, anti-HA antibody was added. Arrow a points at anti-HA-antibody/NFI-A/DNA super-shifted complexes, while arrow b indicates NFI-A/DNA complexes. B, Competition analysis with the radioactively labeled NFI binding site from the mouse L1 gene regulatory region (L) and various unlabeled competitor oligonucleotides (N, Nc, L, Lc; see Fig. 3 for a description). The 32P-labeled L oligonucleotide was incubated with extracts from CHO cells transfected with pCHNFI-A (NFI-A st) in the presence of different molar excesses of the unlabeled competitor oligonucleotides as indicated above the autoradiogram. A "-" indicates that oligonucleotides were not pre-incubated with cell extracts (negative control). The arrow points at the main band representing NFI-A-DNA complexes.
In competition experiments, the L oligonucleotide was more effective than the N oligonucleotide (Fig. 4B), implicating a higher affinity of NFI-A to the site in the L1 gene as compared to the idealized consensus site. The point-mutated oligonucleotides Lc and Nc were unable to compete with the intact binding motifs. We conclude that, in vitro, NFI-A binds to its recognition site in the first intron of the mouse L1 gene, and that this interaction is tight and specific.
The brain-specific isoform of NFI-A binds to the regulatory region of the mouse L1 gene in vivo
NFI-A binds to the L1 gene in vivo. A, ChIP analysis of N2A cells expressing Myc-NFI-A. L1, NFI-A-DNA complexes in the region of the L1 gene containing the NFI full binding site were assayed by PCR using primers indicated in Fig. 1A. Lanes: NFI-A bs, precipitation from Myc-NFI-A bs-transfected cells; NFI-A st, precipitation from Myc-NFI-A st-transfected cells; mock, precipitation from mock-transfected cells; pos, positive control (mouse genomic DNA as PCR template); water, water control (without PCR template). Chst8 and Chst11, To further confirm the specificity of ChIP analysis, ChIP samples were analyzed by PCR using primers amplifying parts of the mouse Chst8 and Chst11 genes, respectively. Note the absence of PCR signals for Chst8 and Chst11 in the ChIP sample lanes. B, Expression of Myc-tagged NFI-A isoforms in N2A cells. N2A cells were transfected with 4.8 μg of NFI-A cDNA expression vectors to express Myc-NFI-A st or Myc-NFI-A bs, respectively, or with 4.8 μg pCMX plasmid ("mock"). 48 h after transfection, cell were lysed and whole cell extracts were analyzed on a 10% SDS-PAGE gel, transferred to nitrocellulose membrane, and probed with anti-Myc antibody for detection of recombinant Myc-NFI-A and with anti-GAPDH antibody to check for loading of comparable protein amounts.
NFI-A represses activity of the L1 gene in mouse neuroblastoma cells
NFI-A represses mouse L1 gene expression. Results of luciferase-based reporter gene assays in N2A cells transfected with L1-11. The L1 reporter plasmid L1-11 contains 2943 bp upstream of exon 1 of the mouse L1 gene, exon 1, intron 1, exon 2 with the luciferase cDNA inserted to replace the L1 start codon by the luciferase start codon, intron 2 including the neural restrictive silencer element, exon 3, intron 3 and exon 4. beta Gal: coexpression of beta-galactosidase (negative control) (n = 98); NFI-A bs: coexpression of NFI-A bs (n = 91); NFI-A bs del: coexpression of NFI-A bs del (n = 35). For titration of beta Gal with NFI-A bs, the beta Gal expression plasmid was gradually replaced with the NFI-A bs expression plasmid at the ratios indicated below, leaving the total amount of transfected DNA constant. "1", bs:Gal = 1:59 (n = 28); "2", bs:Gal = 1:11 (n = 35); "3", bs:Gal = 1:5 (n = 49); "4", bs:Gal = 1:2 (n = 21); "5", bs:Gal = 1:1 (n = 49); "6", bs:Gal = 2:1 (n = 21). Data were acquired from 3 (bs:Gal = 1:2) to 9 (beta Gal, NFI-A bs) independent experiments. For normalization, luciferase activity was divided by the fluorescence of coexpressed EGFP. The relative luciferase activity of the beta Gal-transfected samples was set to 1. **, p < 0.01 vs. beta Gal; ***, p < 0.001 vs. beta Gal; §§§, p < 0.001 vs. NFI-A bs (two-tailed, unpaired t-test).
Discussion
The cell adhesion molecule L1 plays a crucial role in mammalian nervous system development, but regulation of its expression at the transcriptional level is only partly understood. Here, using EMSA and antibody supershift experiments, we showed that the site-specific transcription factor NFI-A specifically interacts with a full NFI recognition site in the first intron of the murine L1 gene. The interaction is very strong, as shown by competition analysis. This high affinity is in accordance with a previous in vitro study, in which the NFI consensus binding motif was determined by PCR-mediated random site selection [20]. We also observed an electrophoretic mobility shift using extracts from cells not transfected with NFI-A expression plasmids, probably caused by expression of endogenous NFI proteins. The respective bands were much weaker when NFI-A was overexpressed, either due to a limiting input or due to a down-regulation of endogenous NFI-A by forced NFI-A expression.
ChIP analysis confirmed that the brain-specific isoform of NFI-A (NFI-A bs) binds to the regulatory region of the mouse L1 gene in vivo as well. By contrast, we did not observe reproducible binding of the ubiquitous NFI-A isoform (NFI-A st) to this genomic region in vivo, although the in vitro interaction of NFI-A st with the full binding site in L1 was at least as strong as the one of NFI-A bs. This difference might be caused by the different binding reaction conditions in the two assays. Alternatively, post-translational modifications could be a reason for the different behavior of NFI-A st and NFI-A bs in the two assays, in particular phosphorylation, which has been implied in regulating NFI activity by several studies [21–23]. Whereas for EMSA, extracts from CHO cells were used, ChIP was performed using N2A cells. It is thus tempting to speculate that phosphorylation of crucial amino acid residues differs between NFI-A bs and NFI-A st in N2A cells, causing a different affinity to the L1 gene regulatory region. Differences in protein phosphorylation or other modifications might also explain why the apparent molecular weights of NFI-A bs and NFI-A st differed slightly more than one would expect from their amino acid composition. Finally, it should be noted that eight half binding sites for NFI proteins can be found in the 2400 bp immediately upstream of the full site. NFI-A binds to such pentanucleotide sequences with a reduced affinity [20].
In order to understand how binding of NFI-A to the L1 regulatory region influences L1 expression, we performed reporter gene assays in mouse neuroblastoma (N2A) cells. NFI-A bs caused a reduction in L1 gene activity to approx. 30% of control level. In this context, it is noteworthy that only the brain-specific isoform significantly interacted with the endogenous L1 gene regulatory region. Moreover, we could nearly abolish repression of L1 transcription by NFI-A bs by deleting NFI-A's transregulatory domain. To our knowledge, these results are the first experimental evidence for a specific role of NFI-A bs in the regulation of a neuronal gene.
How could NFI-A activity at the L1 gene regulatory region be regulated in a physiological context? Several studies suggest that NFI activity is modulated by NFI phosphorylation [21–23]. In our case, NFI-A could be inactivated by phosphorylation, leading to enhanced L1 expression. However, there is no direct evidence that phosphorylation affects NFI activity.
Interactions with other site-specific transcription factors might also regulate transactivation/transrepression by NFI-A. NFI proteins physically interact with TTF-1 [24], Oct-1 [25], ski [26], and CBP [27]. Binding of NFI-A to such factors could alter its inhibitory influence on L1 transcription initiation. Remarkably, the HPD element, which is responsible for stimulation of L1 expression by Pax-6, is located in the same part of the L1 gene as the full NFI binding site identified in our study [6]. In addition, binding of the homeodomain proteins Barx-2 [6] and Hoxa-1 [5] to the L1 gene is also mediated by the HPD element. This might implicate a functional interaction between NFI transcription factors and Pax-6, Barx-2, or Hoxa-1 in regulating L1 expression.
Conclusions
In summary, our data suggest that NFI-A is a repressor of mouse L1 gene activity. A role for NFI-A in regulating L1 expression during development is plausible, as expression of both genes starts around embryonic day 9 in the developing nervous system of the mouse [3, 11]. In addition, Kallunki et al. [3] have proposed a second silencer element in the first intron of the L1 gene that functions together with the NRSE to regulate L1 expression. NFI-A, binding tightly to its recognition motifs in this intron and repressing L1 expression, could be part of the proposed silencer. It may prevent L1 expression at inappropriate stages or cell types, like glia of the central nervous system, consistent with the recently demonstrated importance of NFI-A for glial cell differentiation [28–31]. As both L1 and NFI-A are crucial for brain development in humans [1, 32], further investigations on regulation of L1 expression by NFI-A, for instance cell type-specific analyses of NFI-A deficient mice during development, are likely to significantly extend our knowledge of human brain formation.
Declarations
Acknowledgements
We thank Ute Süsens and Peggy Putthoff for expert technical assistance. Pekka Kallunki (H. Lundbeck A/S, Valby, Denmark) generously provided us with L1-luciferase reporter constructs. The galactosidase plasmid was a gift of Ronald M. Evans (Salk Institute, La Jolla, CA, USA). This work was supported by the European Union program "Role of CAMs in ageing", QLK6-CT-1999-02187 (to M.S.), and the German Federal Ministry of Education and Research, project no. 0311762/8 (to M.S.).
Authors’ Affiliations
References
- Kenwrick S, Watkins A, De Angelis E: Neural cell recognition molecule L1: relating biological complexity to human disease mutations. Hum Mol Genet. 2000, 9: 879-886. 10.1093/hmg/9.6.879View ArticlePubMedGoogle Scholar
- Wiencken-Barger AE, Mavity-Hudson J, Bartsch U, Schachner M, Casagrande VA: The role of L1 in axon pathfinding and fasciculation. Cereb Cortex. 2004, 14: 121-131. 10.1093/cercor/bhg110View ArticlePubMedGoogle Scholar
- Kallunki P, Edelman GM, Jones FS: Tissue-specific expression of the L1 cell adhesion molecule is modulated by the neural restrictive silencer element. J Cell Biol. 1997, 138: 1343-1354. 10.1083/jcb.138.6.1343PubMed CentralView ArticlePubMedGoogle Scholar
- Kallunki P, Edelman GM, Jones FS: The neural restrictive silencer element can act as both a repressor and enhancer of L1 cell adhesion molecule gene expression during postnatal development. Proc Natl Acad Sci USA. 1998, 95: 3233-3238. 10.1073/pnas.95.6.3233PubMed CentralView ArticlePubMedGoogle Scholar
- Chalepakis G, Wijnholds J, Giese P, Schachner M, Gruss P: Characterization of Pax-6 and Hoxa-1 binding to the promoter region of the neural cell adhesion molecule L1. DNA Cell Biol. 1994, 13: 891-900. 10.1089/dna.1994.13.891View ArticlePubMedGoogle Scholar
- Meech R, Kallunki P, Edelman GM, Jones FS: A binding site for homeodomain and Pax proteins is necessary for L1 cell adhesion molecule gene expression by Pax-6 and bone morphogenetic proteins. Proc Natl Acad Sci USA. 1999, 96: 2420-2425. 10.1073/pnas.96.5.2420PubMed CentralView ArticlePubMedGoogle Scholar
- Gavert N, Conacci-Sorrell M, Gast D, Schneider A, Altevogt P, Brabletz T, Ben Ze'ev A: L1, a novel target of beta-catenin signaling, transforms cells and is expressed at the invasive front of colon cancers. J Cell Biol. 2005, 168: 633-642. 10.1083/jcb.200408051PubMed CentralView ArticlePubMedGoogle Scholar
- Kajimura D, Dragomir C, Ramirez F, Laub F: Identification of genes regulated by transcription factor KLF7 in differentiating olfactory sensory neurons. Gene. 2007, 388: 34-42. 10.1016/j.gene.2006.09.027View ArticlePubMedGoogle Scholar
- Gronostajski RM: Roles of the NFI/CTF gene family in transcription and development. Gene. 2000, 249: 31-45. 10.1016/S0378-1119(00)00140-2View ArticlePubMedGoogle Scholar
- Mason S, Piper M, Gronostajski RM, Richards LJ: Nuclear factor one transcription factors in CNS development. Mol Neurobiol. 2009, 39: 10-23. 10.1007/s12035-008-8048-6View ArticlePubMedGoogle Scholar
- Chaudhry AZ, Lyons GE, Gronostajski RM: Expression patterns of the four nuclear factor I genes during mouse embryogenesis indicate a potential role in development. Dev Dyn. 1997, 208: 313-325. 10.1002/(SICI)1097-0177(199703)208:3<313::AID-AJA3>3.0.CO;2-LView ArticlePubMedGoogle Scholar
- Field J, Nikawa J, Broek D, MacDonald B, Rodgers L, Wilson IA, Lerner RA, Wigler M: Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol Cell Biol. 1988, 8: 2159-2165.PubMed CentralView ArticlePubMedGoogle Scholar
- Kruse U, Sippel AE: The genes for transcription factor nuclear factor I give rise to corresponding splice variants between vertebrate species. J Mol Biol. 1994, 238: 860-865. 10.1006/jmbi.1994.1343View ArticlePubMedGoogle Scholar
- das Neves L, Duchala CS, Tolentino-Silva F, Haxhiu MA, Colmenares C, Macklin WB, Campbell CE, Butz KG, Gronostajski RM: Disruption of the murine nuclear factor I-A gene (Nfia) results in perinatal lethality, hydrocephalus, and agenesis of the corpus callosum. Proc Natl Acad Sci USA. 1999, 96: 11946-11951. 10.1073/pnas.96.21.11946PubMed CentralView ArticlePubMedGoogle Scholar
- Umesono K, Murakami KK, Thompson CC, Evans RM: Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell. 1991, 65: 1255-1266. 10.1016/0092-8674(91)90020-YView ArticlePubMedGoogle Scholar
- Hentschke M, Süsens U, Borgmeyer U: Domains of ERRgamma that mediate homodimerization and interaction with factors stimulating DNA binding. Eur J Biochem. 2002, 269: 4086-4097. 10.1046/j.1432-1033.2002.03102.xView ArticlePubMedGoogle Scholar
- Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M: Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell. 2000, 103: 843-852. 10.1016/S0092-8674(00)00188-4View ArticlePubMedGoogle Scholar
- Goyal N, Knox J, Gronostajski RM: Analysis of multiple forms of nuclear factor I in human and murine cell lines. Mol Cell Biol. 1990, 10: 1041-1048.PubMed CentralView ArticlePubMedGoogle Scholar
- Kalus I, Schnegelsberg B, Seidah NG, Kleene R, Schachner M: The proprotein convertase PC5A and a metalloprotease are involved in the proteolytic processing of the neural adhesion molecule L1. J Biol Chem. 2003, 278: 10381-10388. 10.1074/jbc.M208351200View ArticlePubMedGoogle Scholar
- Osada S, Daimon S, Nishihara T, Imagawa M: Identification of DNA binding-site preferences for nuclear factor I-A. FEBS Lett. 1996, 390: 44-46. 10.1016/0014-5793(96)00622-9View ArticlePubMedGoogle Scholar
- Cooke DW, Lane MD: The transcription factor nuclear factor I mediates repression of the GLUT4 promoter by insulin. J Biol Chem. 1999, 274: 12917-12924. 10.1074/jbc.274.18.12917View ArticlePubMedGoogle Scholar
- Bisgrove DA, Monckton EA, Packer M, Godbout R: Regulation of brain fatty acid-binding protein expression by differential phosphorylation of nuclear factor I in malignant glioma cell lines. J Biol Chem. 2000, 275: 30668-30676. 10.1074/jbc.M003828200View ArticlePubMedGoogle Scholar
- Nilsson J, Bjursell G, Kannius-Janson M: Nuclear Jak2 and transcription factor NF1-C2: a novel mechanism of prolactin signaling in mammary epithelial cells. Mol Cell Biol. 2006, 26: 5663-5674. 10.1128/MCB.02095-05PubMed CentralView ArticlePubMedGoogle Scholar
- Bachurski CJ, Yang GH, Currier TA, Gronostajski RM, Hong D: Nuclear factor I/thyroid transcription factor 1 interactions modulate surfactant protein C transcription. Mol Cell Biol. 2003, 23: 9014-9024. 10.1128/MCB.23.24.9014-9024.2003PubMed CentralView ArticlePubMedGoogle Scholar
- van Leeuwen HC, Rensen M, Vliet van der PC: The Oct-1 POU homeodomain stabilizes the adenovirus preinitiation complex via a direct interaction with the priming protein and is displaced when the replication fork passes. J Biol Chem. 1997, 272: 3398-3405. 10.1074/jbc.272.6.3398View ArticlePubMedGoogle Scholar
- Tarapore P, Richmond C, Zheng G, Cohen SB, Kelder B, Kopchick J, Kruse U, Sippel AE, Colmenares C, Stavnezer E: DNA binding and transcriptional activation by the Ski oncoprotein mediated by interaction with NFI. Nucleic Acids Res. 1997, 25: 3895-3903. 10.1093/nar/25.19.3895PubMed CentralView ArticlePubMedGoogle Scholar
- Leahy P, Crawford DR, Grossman G, Gronostajski RM, Hanson RW: CREB binding protein coordinates the function of multiple transcription factors including nuclear factor I to regulate phosphoenolpyruvate carboxykinase (GTP) gene transcription. J Biol Chem. 1999, 274: 8813-8822. 10.1074/jbc.274.13.8813View ArticlePubMedGoogle Scholar
- Deneen B, Ho R, Lukaszewicz A, Hochstim CJ, Gronostajski RM, Anderson DJ: The Transcription Factor NFIA Controls the Onset of Gliogenesis in the Developing Spinal Cord. Neuron. 2006, 52: 953-968. 10.1016/j.neuron.2006.11.019View ArticlePubMedGoogle Scholar
- Barry G, Piper M, Lindwall C, Moldrich R, Mason S, Little E, Sarkar A, Tole S, Gronostajski RM, Richards LJ: Specific glial populations regulate hippocampal morphogenesis. J Neurosci. 2008, 28: 12328-12340. 10.1523/JNEUROSCI.4000-08.2008View ArticlePubMedGoogle Scholar
- Namihira M, Kohyama J, Semi K, Sanosaka T, Deneen B, Taga T, Nakashima K: Committed neuronal precursors confer astrocytic potential on residual neural precursor cells. Dev Cell. 2009, 16: 245-255. 10.1016/j.devcel.2008.12.014View ArticlePubMedGoogle Scholar
- Wilczynska KM, Singh SK, Adams B, Bryan L, Rao RR, Valerie K, Wright S, Griswold-Prenner I, Kordula T: Nuclear factor I isoforms regulate gene expression during the differentiation of human neural progenitors to astrocytes. Stem Cells. 2009, 27: 1173-1181. 10.1002/stem.35PubMed CentralView ArticlePubMedGoogle Scholar
- Lu W, Quintero-Rivera F, Fan Y, Alkuraya FS, Donovan DJ, Xi Q, Turbe-Doan A, Li QG, Campbell CG, Shanske AL, Sherr EH, Ahmad A, Peters R, Rilliet B, Parvex P, Bassuk AG, Harris DJ, Ferguson H, Kelly C, Walsh CA, Gronostajski RM, Devriendt K, Higgins A, Ligon AH, Quade BJ, Morton CC, Gusella JF, Maas RL: NFIA haploinsufficiency is associated with a CNS malformation syndrome and urinary tract defects. PLoS Genet. 2007, 3: e80- 10.1371/journal.pgen.0030080PubMed CentralView ArticlePubMedGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Comments
View archived comments (1)