Skip to main content

Advertisement

Table 3 Details of candidate reference genes and primers used for RT-qPCR studies in Thrips tabaci

From: RNA sequencing, selection of reference genes and demonstration of feeding RNAi in Thrips tabaci (Lind.) (Thysanoptera: Thripidae)

Gene symbol Locus description Homolog locus Primer sequence (5′→3′) Identity E-value
ACTIN Actin-muscle-specific KMQ83754 Fwd: CCCTCCACCATCAAGATCAA Rev: AGATCCACATGGACTGGAA 97 7.69437E−38
18s 18s rRNA XP_015126904 Fwd: CTCGAAATGCTCGAGGAAAG Rev: GAATCAGGACGTGTCTCTAACC 89 3.3679E−150
28s 28s ribosomal protein S29, mitochondrial KDR19525 Fwd: GAGGGATGGGAACACATTG Rev: AAGCGCCGATCTATGTAGAAG 65 8.4952E−123
TUB Tubulin gamma-2 chain KDQ97903 Fwd: GGTTGATCCCACTCAAGTTC Rev: GGTGATTTGCGAGATAGAGC 95 0
GADPH Glyceraldehyde-3-phosphate dehydrogenase 2 XP_014230283 Fwd: GAGGTTGTGTCCTCTGACTT GCCATACTCATTGTCGTACC 95 0
EF transcription elongation factor SPT5, putative XP_002428957 Fwd: GGACCTTACACTCCACAAAC Rev: GGACCCTTGATAACCTGTTG 81 0
RPL17 60S ribosomal protein L17 KDR19552 Fwd: CACATCGAAGTAGTGCTGAC Rev: GTTTGGCGAGCTTCTTCTTG 95 2.44944E−82
Hist3 Histone-lysine N-methyltransferase, H3 lysine-9 specific 5 KDR11973 Fwd: CAGGACAGCGAACTTATGAC Rev: CCATCTGATCCCTGATGTGT 65 0
UbiCE ubiquitin conjugating enzyme XP_954044 Fwd: ACCCAAACATAGGACTGTCG Rev: TGGATCAGCTAGGAGAGACT 53 1.31285E−26
TATA TATA box-binding protein-like protein 1 KDR19315 Fwd: ACGTGGACTCAAGGATAGTG Rev: TCCCAGTCTTCATCATCTGC 88 3.6384E−116
E2F Transcription factor E2F1 XP_012270447 Fwd: GCCGATTAAACCTGGAGTCT Rev: GGGCTACCATATGAGCTGTT 60 8.7238E−111
vATPase V-ATPase holoenzyme subunit B AJM13638 Fwd: CCAGGAAAGACCACTCTGAT Rev: GTCAATGCCTCTTCACCAAC 99 0
SOD Mn superoxide dismutase AIG92784 Fwd: CAAGGCAGTTGGTGTTCAAG Rev: TGCAGAGGATCTTGGTTAGC 75 5.58161E−69
GSTD2 Glutathione s-transferase D2 AFJ75818 Fwd: GTTTCAAGAGCGTCGTCAAC Rev: GACACACTCACACACACTCA 79 1.3299E−84