Skip to main content

Table 2 Primers used for the strain construction in this study

From: HexA is required for growth, aflatoxin biosynthesis and virulence in Aspergillus flavus

Primers Sequence (5′–3′) Description
PyrG/F GCCTCAAACAATGCTCTTCACCC HexA deletion (A. fumigatus pyrG)
P801-R CAGGAGTTCTCGGGTTGTCG hexA mutant screen
hexA-O-F TGGGTTATGCCTGTTCTGG hexA mutant screen
Step1-F GGGCAGTAGGTATTGTAGGT hexA complementation