Skip to main content

Advertisement

Table 2 Primers used for the strain construction in this study

From: HexA is required for growth, aflatoxin biosynthesis and virulence in Aspergillus flavus

Primers Sequence (5′–3′) Description
hexA-A-F TCCTCGTAACTTTATCACCG hexA deletion
hexA-A-R GGGTGAAGAGCATTGTTTGAGGCTTCGTTCTTCACGGGTTG
hexA-B-F GCATCAGTGCCTCCTCTCAGACCTCAACGCCTCGTAAACA
hexA-B-R GTGGCAGCAAGAGTATGG
hexA-ORF-F TCCATTCAGCCAGCAACA
hexA-ORF-R ACACGGGCGTCAAAGTCC
PyrG/F GCCTCAAACAATGCTCTTCACCC HexA deletion (A. fumigatus pyrG)
PyrG/R GTCTGAGAGGAGGCACTGATGC
P801-R CAGGAGTTCTCGGGTTGTCG hexA mutant screen
P1020-F ATCGGCAATACCGTCCAGAAGC
hexA-O-F TGGGTTATGCCTGTTCTGG hexA mutant screen
hexA-O-R GGTTTCTTTCTCGGGTGC
Step1-F GGGCAGTAGGTATTGTAGGT hexA complementation
Step1-R CCTCGGTTCACTACAGCAC
ORF-UTR-F TCAAGAGCCTACCTCATACC
ORF-UTR-R GGGTGAAGAGCATTGTTTGAGGCACAAGCCACTTCCACCC
UTR-F GCATCAGTGCCTCCTCTCAGACTCAACGCCTCGTAAACA
UTR-R TGGCAGCAAGAGTATGG
Overlap-F AGCCAGTCAACCCACCT
Overlap-R CTTACGGCATTAGTACATTTCT