Skip to main content

Table 4 The most abundant novel candidate miRNAs identified from HIST and NC libraries

From: Genome-wide identification of brain miRNAs in response to high-intensity intermittent swimming training in Rattus norvegicus by deep sequencing

miRNA name Sequence Length Count Precursor location MFEa MFEIb
rno-miR-n048_5p CAGTGGTTTTACCCTATGGTAG 22 2605 2040 19:37422715:37422794:+ − 48.2 1.24
rno-miR-n026_5p AATGTGACTCAGCTATCTGAAC 22 710 457 8:55466028:55466104:− − 44.3 1.23
rno-miR-n031_3p TCAGTAGGCCAGACAGCAAGC 21 588 453 11:36339323:36339403:− − 39.6 0.86
rno-miR-n044_5p TGTGTTTTGTGTGTGTACATGT 22 231 170 17:79266887:79266980:− − 49.0 1.26
      17:79268511:79268591:− − 33.8 1.06
      17:79270548:79270628:− − 38.0 1.19
      17:79273909:79273989:− − 38.0 1.15
      17:79275714:79275805:− − 40.3 1.12
      17:79276506:79276586:+ − 38.0 1.15
      17:79281787:79281880:− − 49.0 1.26
      17:79283453:79283546:− -47.1 1.24
      17:79285357:79285437:− − 33.8 1.06
      17:79277748:79277828:− − 33.7 1.05
      17:79264421:79264501:− − 38.0 1.19
rno-miR-n025_3p ATGGTAATGGTGGTGGTGATGG 22 213 108 8:64686682:64686763:+ − 46.0 1.44
rno-miR-n002_3p CATAAGTGTAGAGAGTCTGTAGT 23 122 59 1:131079839:131079925:+ − 31.3 0.95
rno-miR-n021_5p TGGTTTACCGTCCCACATACA 21 77 57 6:134389818:134389888:+ − 43.5 1.45
rno-miR-n022_3p AAGGGCAAGCTCTCTTCGAGG 21 46 36 6:134405230:134405322:+ − 42.7 1.07
rno-miR-n014_5p TACAGTTAGACGTAGAGACCAT 22 49 31 3:153140628:153140705:− − 35.0 1.21
rno-miR-n001_3p CTCTAGCCAGGGCTTGACTGC 21 48 24 1:116347377:116347469:− − 53.3 0.95
      1:116214989:116215081:+ − 54.6 0.99
  1. aMFE denotes minimum free energy, and its unit is kcal/mol
  2. bMFEI denotes minimum free energy index