Skip to main content

Advertisement

Table 5 Primers designed for qRT-PCR validation of candidate lncRNAs and mRNAs

From: Analyses of changes in myocardial long non-coding RNA and mRNA profiles after severe hemorrhagic shock and resuscitation via RNA sequencing in a rat model

Gene Forward primer Reverse primer Product length
NONRATT006032 TCTGACCTCGGAGTGTGCTA ACAGCCATCACGGACTCAAG 267
NONRATT006033 AAATACTGCTGTGGAGCGGG GATGCTGACGTGAAGTGTGC 247
NONRATT006034 TACCAAGCAGCAGCTGAACA GGGGCGACAATACTTTCCGA 148
NONRATT006035 GGACTTCATGGTAGGACGGG TGAGGCTCTCCACTCTGTGT 173
NONRATT029969 CTATGTTTGACAGCCGAGTTG AGTCTCACAGAGGGATTATGGTT 158
Stat3 AACGACCTGCAGCAATACCA TCCATGTCAAACGTGAGCGA 135
Il1r1 ACAGGGACTCCTGCTCTGAT TCCCTCTCCGTAGGTCTTGG 95