Skip to main content

Advertisement

Table 5 The read counts and sequences of A. gossypii miRNAs that had decreased expression following plant allelochemical treatment

From: Identification of microRNAs and their response to the stress of plant allelochemicals in Aphis gossypii (Hemiptera: Aphididae)

miRNA name miRNA sequence Control 2-tridecanone Tannic acid Quercetin Gossypol
Ago-let-7-5p TGAGGTAGTTGGTTGTATAGT 2943 673 2378 811 1586
Ago-miR-100-5p GACCCGTAGATCCGAACTTGTG 2501 803 1521 1171 962
Ago-miR-44b-3p TGACTAGAGTTTATACTACCGA 1475 497 1375 606 835
Ago-miR-7054-3p CCAACTTGGCAGCTTCTGA 158 17 25 52 95
Ago-miR-4021-3p TAAGTATTTGGCTCTTGG 52 3 2 10 22
Ago-miR-656a-3p CATATTATGGTCGTGAGTA 24 2 2 3 10
Ago-miR-466la-3p TATAAATATTGTAGGTACC 23 1 2 5 3
Ago-miR-2238j-3p TATGACGAGAGGGCAAAT 16 0 0 6 7