Skip to main content

Advertisement

Table 3 Primer sequences for candidate normalization genes.

From: Selection and validation of a set of reliable reference genes for quantitative sod gene expression analysis in C. elegans

Gene symbol Sequence name Forward primer Reverse primer Amplicon size
act-1 T04C12.6 gctggacgtgatcttactgattacc gtagcagagcttctccttgatgtc 114
ama-1 F36A4.7 cctacgatgtatcgaggcaaa cctccctccggtgtaataatg 139
cdc-42 R07G3.1 ctgctggacaggaagattacg ctcggacattctcgaatgaag 111
csq-1 F40E10.3 aactgaggttctgaccgagaag tactggtcaagctctgagtcgtc 111
eif-3.C T23D8.4 gctgagactgttaagggaatgg gagcgaaacagtggcataaac 99
mdh-1 F20H11.3 ctcgtgacgatctcttcaacac gtcatagacaccagccttcttgag 161
gpd-2 K10B3.8 ctccatcgactacatggtctacttg agctgggtctcttgagttgtagac 151
pmp-3 C54G10.3 gttcccgtgttcatcactcat acaccgtcgagaagctgtaga 115
tba-1 F26E4.8 gtacactccactgatctctgctgacaag ctctgtacaagaggcaaacagccatg 194
Y45F10D.4 Y45F10D.4 gtcgcttcaaatcagttcagc gttcttgtcaagtgatccgaca 139