Skip to main content

Table 2 PCR primers for quantitative chromatin immunoprecipitation assays

From: FIZ1 is part of the regulatory protein complex on active photoreceptor-specific gene promoters in vivo

Gene ChIP Antibody Positions† Sense primer Anti sense primer bp
Rho Pol-II-S2 +3051 to +3199 ggagatcccatgcacaaagt taagctccctgccacttgac 149
Rho FIZ1 -711 to -570 cagcaggccagtaggatca gaggaggggcgtaagaagtt 141
Rho FIZ1 -12 to +130 cccctctgcaagccaatta gcaactccaggcactgac 142
Untr6 Pol-II-S2 FIZ1 4.4 × 106 bp downstream of Rho tcaggcatgaaccaccatac aacatccacacgtccagtga 216
  1. †Relative to the transcriptional start site (+1).
  2. Rho (Rhodopsin), Untr6 (untranslated region Chromosome-6), Pol-II-S2