FIZ1 is part of the regulatory protein complex on active photoreceptor-specific gene promoters in vivo

BMC Molecular Biology

Table 2 PCR primers for quantitative chromatin immunoprecipitation assays

Gene	ChIP Antibody	Positions†	Sense primer	Anti sense primer	bp
Rho	Pol-II-S2	+3051 to +3199	ggagatcccatgcacaaagt	taagctccctgccacttgac	149
Rho	FIZ1	-711 to -570	cagcaggccagtaggatca	gaggaggggcgtaagaagtt	141
Rho	FIZ1	-12 to +130	cccctctgcaagccaatta	gcaactccaggcactgac	142
Untr6	Pol-II-S2 FIZ1	4.4 × 10⁶ bp downstream of Rho	tcaggcatgaaccaccatac	aacatccacacgtccagtga	216

ISSN: 1471-2199