Skip to main content

Table 3 C/EBPδ and C/EBPδ target gene primers (mouse)

From: Identification and characterization of CCAAT/Enhancer Binding proteindelta (C/EBPdelta) target genes in G0 growth arrested mammary epithelial cells

   Sequence (5'-3') Length (bp)a Accession No.b
C/EBPδ FW CGACTTCAGCGCCTACATTGA 171 bp NM007679
  RV CTAGCGACAGACCCCACAC   
ASAHL FW GTCCTCCTGACTTCCTGG 225 bp NM025972
  RV CCTGCCACTAAGCCTCAC   
BCAT2 FW ATGAAGGCAAGCAACTCC 227 bp NM009737
  RV TGGACAGACCTTTCCCTATT   
GP5 FW CGCCAGCCTGTCGTTCT 185 bp NM008148
  RV GCCTGTTATTGGGACTTTCAC   
ITGB8 FW TTCTCCTGTCCCTATCTCCA 302 bp NM177290
  RV TGAGACAGAT TGTGAGGGTG   
MKL2 FW CTGTGGTCGTCAAGCAAGA 398 bp NM153588
  RV TGTGTTTGGTGCCGAGTTT   
MSH5 FW CGACTCCTGAGCCACATC 295 bp NM013600
  RV TGGCATCTATGTCAGGGTC   
OXA1L FW CGGTTCTATTGCCGTTGG 225 bp NM026936
  RV CACCCACTCCTCTTTCCTTT   
PCDH9 FW ACAGCCACCACGGTCCTCTA 219 bp NM001081377
  RV CCCTTGTTGTTCCCGCTCAC   
SCAP2 FW AGTGAAGATGGACGAGCAA 199 bp NM018773
  RV TCCTACCCACCAGCCATA   
T1A1 FW GAGAAGGGCTATTCGTTTG 208 bp NM009383
  RV GTCCATACTGTTGTGGGTTT   
VDR FW CAACGCTATGACCTGTGAA 299 bp NM009504
  RV GCAGGATGGCGATAATGT   
XPC FW TCCTGGGAGATACCTTCG 337 bp NM009531
  RV AAAGAGCAGCAGGCAGTA   
GAPDH FW CTCACTGGCATGGCCTTCCG 293 bp XM001473623
  RV ACCACCCTGTTGCTGTAGCC   
  1. Note. FW: forward primer; RV: reverse primer.
  2. aAmplicon length in base pairs.
  3. bGenbank accession number of corresponding gene, availabe at http://www.ncbi.nlm.nih.gov