Skip to main content

Table 2 Forward (F-) and reverse (R-) primers for ChIP and RT-PCR assays (human)

From: Identification and characterization of CCAAT/Enhancer Binding proteindelta (C/EBPdelta) target genes in G0 growth arrested mammary epithelial cells

Gene name Primers for ChIP Primers for RT-PCR
DIRAS3 F- ctcacaggcaagggagaaag; F- ccgaagggccaagtggaggaagc;
  R- tacaggttggggaggaactg R- tggtgaggcagccccgttgtt
ASAHL F- gcagagacacaccagcagag; F- gtggctcaagactccagagg;
  R- gtaagccgtggaggaggag R- tgcttcgaagttttccgact
BCAT2 F- aagaggccttgtgaggtcaa; F- ccgctgaatggtgttatcct;
  R- ctcgctggaaagagctgagt R- tctccttcagctccttctgg
BCL2L1 F- agagctcttgcgtctggaag, F- agagctcttgcgtctggaag;
  R- ggacttctcaatggggttca R- ggacttctcaatggggttca
CCRN4L F- cctgaccatgtctttgctca; F- ctggagcccattgatcctaa;
  R- cgcaggcggtctaaaataag R- ggtaggccaggatttcttcc
SEPT7 F- ggagtgtgagctccaagagg; F- aatagttgataccccaggat;
  R- cttgcttacgcacgctacag R- gagcaatgaagtataaacaacac
FGF9 F- ctctcgcagtgcatctttca; F- tgagaagggggagctgtatgga;
  R- tcccatccgaccgtaataag R- gtgaatttctggtgccgtttagtc
GPR160 F- aaggttgcccgtctctgac; F- gctctcgcttcgtcctacac;
  R- gcctcggaaaacaaatagcc R- taggggctggtttgtttgac
ITGB8 F- caagtcctcacacccatcct; F- gctctcgcttcgtcctacac;
  R- ccttcccagtaaacggaaca R- taggggctggtttgtttgac
MKL2 F- ctctgtcctgtgtgccattc; F- ctgtcctccccacaaacact;
  R- cgtgactgggaagggttaaa R- gatctgcagttgcaggaaca
MSH5 F- atgttcaccgctttgagtcc; F- gagacgctgctgatgtacca;
  R- ccagcctagagatccgacag R- cctgatgagttgggtccagt
OXA1L F- agcctcccaaagtgatgaga; F- agaatgatgcccctgataacctt;
  R- gtcgcgattgtcctctgatt R- gacgcgtcatttcagcatttttc
SCAP2 F- cgagctcagaggccatcgtagggt; F- ctcccaaagatgctgaaga;
  R- gaagatcttcccggccccagaaga R- tgcttgttagtggattgcttat
VDR F- ctggatgattttgtgagca; F- cagtttgggaggtcgaggta;
  R- aattttcatcgaccgtcgtc R- gaatgagagtgggggtctga