Skip to main content

Table 1 Selected candidate reference genes used in the Real-time RTqPCR assay indicating name, GenBank accession number or reference, function, annealing temperature (Ta), PCR efficiency, regression coefficient and primers used for the expression study.

From: Evaluation of suitable reference genes for gene expression studies in bovine muscular tissue

Gene Full gene name GenBank accession number or reference Function Ta PCR efficiency Regression coefficient (r2) Forward primer Reverse primer
18S 18S ribosomal RNA DQ222453.1 Ribosomal eukaryotic small subunit 57°C 101.1% 0.983 CGGCTACCACATCCTATGAA TGGAGCTGGAATTACCGCGG
ACTB β-actin Goossens et al., 2005 Cytosqueletal structural protein 59°C 97.0% 0.982 CCTCACGGAACGTGGTTACA TCCTTGATGTCACGCACAATTT
B2M β-2-microglobulin NM_173893.2 Beta-chain of major histocompatibility complex class I molecules 59°C 99.1% 0.981 AGTAAGCCGCAGTGGAGGT CGCAAAACACCCTGAAGACT
CASC3 cancer susceptibility candidate 3 XM_610173.2 Linked to development of breast cancer 57°C 97.8% 0.95 TACATCCCCACCAGACACC GGAGCAGAAAAGTAAGTAGGAGCA
EEF1A2 eukaryotic translation elongation factor 1 alpha 2 BC108110.1 Translation elongation factor activity 59°C 99.3% 0.972 GCAGCCATTGTGGAGATG ACTTGCCCGCCTTCTGTG
GAPDH glyceraldehyde-3-phosphate dehydrogenase NM_001034034.1 Oxidoreductase in glycolysis and gluconeogenesis 59°C 99.6% 0.979 TGCACCACCAACTGCTTGGC GGCATGGACGGTGGTCATGAG
HMBS hydroxymethylbilane synthase BC112573.1 Heme synthesis, porphyrin metabolism 59°C 95.4% 0.988 CTTTGGAGAGGAATGAAGTGG AATGGTGAAGCCAGGAGGAA
RPII polymerase (RNA) II (DNA directed) polypeptide A (220 kD) NM_000937.2 DNA-directed RNA polymerase II subunit 59°C 103.6% 0.988 ACCCACTAGCCCCACCTACT GCTCACCCTCAGTTCTCGTC
SF3A1 splicing factor 3 subunit 1 XM_878187.1 Structural component of the splicing system 57°C 95.0% 0.981 GCGGGAGGAAGAAGTAGGAG TCAGCAAGAGGGACACAAA
UBC Ubiquitin C Chitko-McKown et al, 2004 Protein degradation 59°C 103.4% 0.976 TCCCTACCTGCATCATGTGC GGAATTTGGGCCAGTGCTC