Skip to main content

Table 3 List of primers for EMSA probes

From: Distinct and stage specific nuclear factors regulate the expression of falcipains, Plasmodium falciparum cysteine proteases

Gene Primer Name Primers 5'-3'
Falcipain 1 Fal 1.1 F ATTCATTCTGTGTCATCTGT
  Fal 1.1 R CTATTTATAAAAAAAATTTC
Falcipain 2 Fal 2.1 F TATATTGTATATAATTTGAGATAATG
  Fal 2.1 F CCCAAGCCGATTATTTTTTTTAAT
  Fal 2.2 F TAAAAAAAATAATCGGCTTGGG
  Fal 2.2 R GACCATGCGCATTTACTAG
  Fal 2.3 F CTAGTAAATGCGCATGGTC
  Fal 2.3 R TAGTGAGGTTTCTATATATTC
Falcipain 2a Fal 2a.1 F CCTTAATAAAAAGAAATGAACAA
  Fal 2a.1 R CACTTTTCCCTATTTTATACTA
  Fal 2a.2 F TAGTATAAAATAGGGAAAAGTGT
  Fal 2a.2 R CATATATTATAATTGTTTCTCTTT
Falcipain 3 Fal 3.1 F CATACAGTTGAAGGGATGAT
  Fal 3.1 R GCATCATAATCAAAATATGGCAT
  Fal 3.2 F ATGCCATATTTTGATTATGAT
  Fal 3.2 R GAATGATTAAAATAATAATAAATAAA
  Fal 3.3 F TTATTATTATTTTAATCATTC
  Fal 3.3 R CTTTGTTCATATTCTTCTTTGT