Skip to main content

Table 2 List of primers and PCR conditions used for making luciferase constructs

From: Distinct and stage specific nuclear factors regulate the expression of falcipains, Plasmodium falciparum cysteine proteases

Gene Primers Primer sequences 5'-3' PCR conditions
    Denaturation Annealing Extension
Falcipain 1 Fal1Luc 1 kb F CTCGAGATTCATTCTGTGTCATCTGT 94°C 1' 53°C 1.30' 68°C 1.30'
  Fal1Luc 0.5 kb F CTCGAGGCCTTTTCTTTCTATTTTAAGC 94°C 1' 53°C 68°C 1'
  Fal1Luc R CCATGTTGTAATCCATGGATTTTTTAT    
Falcipain 2 Fal2Luc 2 kb F CTCGAGTATATTGTATGTAATTTGAGATAATGA 94°C 1' 52°C 1.30' 62°C 2'
  Fal2Luc 1 kb F CTCGAGTGAATATATAGAAACCTCACTAGG 94°C 1' 55°C 1.30' 68°C 1.30'
  Fal2Luc 0.5 kb F CTCGAGAATTCATTGCATTTATGTGTTTTCTA 94°C 1' 53°C 1' 68°C 1'
  Fal2Luc R CATGTGGTAATCCATGGTCTTCAAC    
Falcipain 2a Fal2aLuc 2 kb F CTCGAGGATGATTTCGCCTTTTATAG 94°C 1' 50°C 2' 65°C 2'
  Fal2aLuc 1 kb F CTCGAGTATGAATATACATATACACTAGG 94°C 1' 52°C 1.30' 65°C 1.30'
  Fal2aLuc 0.5 kb F CTCGAGAAAGATAAGCAACATCGATT 94°C 1' 53°C 1' 68°C 1'
  Fal2aLuc R CATGTGGTAATCCATGGTTAAAA    
Falcipain 3 Fal3Luc 2 kb F CTCGAGCATACAGTTGAAGGGATGATG 94°C 1' 52°C 1.30' 62°C 2'
  Fal3Luc 1 kb F CTCGAGACAAAGAAGAATATGAACAAAG 94°C 1' 55°C 1.30' 68°C 1.30'
  Fal3Luc 05.kb F CTCGAGTTCGAAAATTTCCGTATACAT 94°C 1' 53°C 1' 68°C 1'
  Fal3Luc R CATATGATATTCCATGGTTCAAAC