Skip to main content

Table 1 PCR primers used in chromatin immunoprecipitation

From: Characterization of two functional NKX3.1 binding sites upstream of the PCAN1 gene that are involved in the positive regulation of PCAN1 gene transcription

Names Sequences Product sizes
NBS1 primers F: GATTCTTTGACTGGTCTGGCACAC  
  R: TTATCCATTGTGCCTGGAGCTGAG 170 bp (spanning NBS1)
BNS2 primers F: TCCTACTAACGGCATGTAAGGAGG  
  R: ATTGCCATGTCTGGACTGTGAGTG 170 bp (spanning NBS2)
NBS3 primers F: AAGAATGAGCTGATCCTCCTATGC  
  R: GGTTTAGTAATAGACTGGGCACCA 150 bp (spanning NBS3)
NBS4,5 primers F: GTGTAGCAGGTAAATCAGTGTGAG  
  R: TCAGCTGACGAGCAACTTCAATTC 180 bp (spanning NBS4 and 5)
  1. NBS1 F and R span NBS1;
  2. NBS2 F and R span NBS2; NBS3 F and R span NBS3; BNS4,5 F and R span NBS4 and NBS5