Skip to main content

Advertisement

Table 3 Sequences of fluorescence hybridization probes

From: Preamplification techniques for real-time RT-PCR analyses of endomyocardial biopsies

Gene name Sequence
TRBC ACGAGTGGACCCAGGATAGGGCCAA
TRBV common probe CACCCGAGGTCGCT
HPRT-CCM TTTCACCAGCAAGCTTGCGACCTTGA
IL10 TTACAGGACCAGAGGGACAAGACATGACTGTG
IFNγ TTTCTGTCACTCTCCTCTTTCCAATTCTTCAAA
TGFβ CACGCAGTACAGCAAGGTCCTGGCC
FoxP3 AGCCGGGAGAGTTTCTCAAGCACTGC
T-bet CACCTGTTGTGGTCCAAGTTTAATCAGCACC
GATA3 TCCTGTGCGAACTGTCAGACCACCAC
GRAIL GGAAGGCTTCAACTACGCACACTGAAACAAG
Granzyme A CTTCCAGAATCTCCAATTGCGCGAGTCTCTTC
Granzyme B CCCACGCACAACTCAATGGTACTGTCG
Granulysin ACCCAGAGAAGTGTTTCCAATGCTGCGAC
Perforin TGCCGCTTCTACAGTTTCCATGTGGTACAC
  1. Sequences of fluorescence hybridization probes of self-designed real-time RT-PCR gene assays. For the different TRBV forward primers, one common MGB hybridization probe was used.