Skip to main content

Table 3 Oligonucleotide primers used for QPCR analysis

From: Expression and characterization of novel ovine orthologs of bovine placental prolactin-related proteins

Gene Primer Sequence Position
oPRP1 Forward 5' ATATGCCCAGGGCAAACTGT 3' 294–313
(AB231297) Reverse 5' AATCGAAGGCATTGGTTTGG 3' 358-339
oPRP2 Forward 5' TGGAAGATGTACGAGGCTCGT 3' 590–610
(AB231298) Reverse 5' CGCCTATCTTCATCGCTGGA 3' 631-612
oGAPDH Forward 5' GCCATCACCATCTTCCAGGA 3' 81–100
(AF030943) Reverse 5' CCACGTACTCAGCACCAGCA 3' 150-131