Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences for MS-PCR, PSQ, BS and MSRE-PCR

From: The use of Multiple Displacement Amplified DNA as a control for Methylation Specific PCR, Pyrosequencing, Bisulfite Sequencing and Methylation-Sensitive Restriction Enzyme PCR

Gene Primer Sequence (5' – 3') Technique Methylated (m)/Unmethylated (u) Reference Base pair location
BRCA-1 F GGTTAATTTAGAGTTTCGAGAGACG MS-PCR m Genbank: NT_010755.15 5001854 – 5001830
  R TCAACGAACTCACGCCGCGCAATCG   m   5001697 – 5001673
  F GGTTAATTTAGAGTTTTGAGAGATG   u   5001854 – 5001830
  R TCAACAAACTCACACCACACAATCA   u   5001697 – 5001673
MMP-2 F GGACGTTAAGGGTTTAGAGC MS-PCR m Genbank: NT_010498.15 9127002 – 9127021
  R CAATACACGACCTCGTCAC   m   9127086 – 9127104
  F GGATGTTAAGGGTTTAGAGT   u   9127002 – 9127021
  R CAATACACAACCTCATCAC   u   9127086 – 9127104
BRCA-1-PSQ- PCRa F TAGGGGGTAGATTGGGTGGTTA PSQ   Genbank: NT_010755.15 5001871 – 5001850
  R CCCCCTCCAAAAAATCTCA     5001675 – 5001656
BRCA-1-PSQ-Sa   TGGGTGGTTAATTTAGAGT     5001859 – 5001841
BRCA-1-PSQ-Sb   TTTGTTTTTAGTTTAGGAAG     5001651 – 5001670
MMP-14 F TTGTAATTGGATTTAGGTTAAAA BS   Genbank: NT_026437.11 4305511 – 4305533
MMP-1 F CCAGGCCTCAGTGGAGCTA MSRE-PCR   Genbank: NT_033899.7 6233232 – 6233214
  R AATGGGAAGACATTCTCACGA     6233000 – 6232982
MMP-3 F CAACTTCAAAGCATCTGCTAATT MSRE-PCR   Genbank: NT_033899.7 6277588 – 6277566
  R ATGGGCAGAATAGAACAAAGAGG     6277355 – 6277333