Skip to main content

Table 1 PCR primers and amplicons

From: Do anesthetics and sampling strategies affect transcription analysis of fish tissues?

Gene Forward primer Reverse primer Amplicon (bp)
Beta-actin CCAAAGCCAACAGGGAGAA AGGGACAACACTGCCTGGAT 92
EF1AB TGCCCCTCCAGGATGTCTAC CACGGCCCACAGGTACTG 59
ARP TCATCCAATTGCTGGATGACTATC CTTCCCACGCAAGGACAGA 101
Na+/K+-ATPase alpha 1b CTGCTACATCTCAACCAACAACAT CACCATCACAGTGTTCATTGGAT 81
HIF1 CCACCTCATGAAGACCCATCA TCTCCACCCACACAAAGCCT 101
  1. Number of base pairs (bp) are given for each amplicon.