Skip to main content

Advertisement

Table 1 PaBaLiS oligonucleotide primers designed in this study.

From: Selection strategy and the design of hybrid oligonucleotide primers for RACE-PCR: cloning a family of toxin-like sequences from Agelena orientalis

Primer name Primer sequence
01F GWNTGYGAYGGIAAYGA
06F TGYATTGCIRARGAYTAYGG
08F AAYTGYAAYTGYTGYGG
10F GATGARAAYTGYTGYAARAA
12F GGAATTCARGCIGARCCNAA
14F CCACAYACNTGYTGYTGGGG
15F AARGAYTGYTGYCARTG
17F CAYGGATGYTGYTGGCCNTG
19F GAYTGYGAYTGYTGYGG
22F TAYATGTTYGGNGGNTG
26F GAAGAATYWAARGGNGARGA
29F AARTGYTGYGAYGAYTG
32F GTCGARTGYTGYAAYGARTG
36F GATTGGTAYGAYGARTGYTG
M08F CCAGGAAAIRAYSARTGYTG
M09F TAYYTTTTYGGIGGNTG
M10F TGYCARTGYGTNATGAA
M11F ATGTGYGARTGYAAYATHATGGG
M12F GGAGRNGAYTGYGAYGG
M13F ACNTGYGAYTGYTGYGG
M14F GAYTGYSARTGYTGYGG
M15f TGGATHGARGAYGGNTGGAA
M16F TGYTGYGGNGARATGTGGTG
M17f ATGTAYTGYMGNATGAT
M18f TGYTGYGARGGIYTITAYTG
M19f TGYTGYGAYGGITGGMGITG
M20f TGYTGYGAYGGITAYTAYTG
M22f TGYTGYWSIGGITAYTAYTG
M23f TGYTGYGAYGGITTYTAYTG
M24f TGYTGYGARGGITTYTAYTG
M25f TGYTGYAARGGITAYTAYT
M26f TGYTGYTCAGGNTTTAGATG
M28f TGYTGYCARGGITAYTAYTG
M31F CTTATTTYKGCHATKGTCTT
M33F ATAACAAAATAACCATGAGAACTA
M35F GAATWTTACAAAWTRACMATGA
M37F TGAGAWAMGAAWYACCACAAA
M39F AAGACAAAGGATTATAAGATG
M41F TTGAAACAGAAAGAGAAGAATG
M43F ATGAAGCTTCTTTTAGCAA
M45F ATGARARCTATMATTTYYYT
M47F AAATTCAGGAGTCGTACAATG
M49F TCAGGTATCCAAGAACAATG
M51F TCCTGGATACAAACCTAAA
  1. Non standard and degenerate nucleotide positions are defined as follows: R = A+G, Y = C+T, N = A+C+G+T, M = A+C, W = A+T, D = G+A+T, I = Inosine, K = G+T, H = A+T+C, S = G+C, B = G+T+C, V = A+C+G