Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Oligonucleotides used to generate constructs of the 3'-UTR of the human CDK5R1 gene.

From: The 3' untranslated region of human Cyclin-Dependent Kinase 5 Regulatory subunit 1 contains regulatory elements affecting transcript stability

Fragment nt (bp) Sequence PCR annealing (°C)
UTR 1–2687 Fw: 5' GC TCTAGA ATCGGTGAGCACTGTGCCTG 3'
Rev: 5' GCTCTAGA GAATCAGCACAGTACAAAAATAAAT 3'
62
C1 1–661 Fw: 5' GCTCTAGA ATCGGTGAGCACTGTGCCTG 3'
Rev: 5' GCTCTAGA AGCAGCAGACAAGGGGGTAG 3'
62
C2 562–1226 Fw: 5' GCTCTAGA TGAGCGGGTCTAGTGGAAAG 3'
Rev: 5' GCTCTAGA GAAAGAAAATCAATAAAGTACAC 3'
58
C2.1 562–661 Fw: 5' GCTCTAGA TGAGCGGGTCTAGTGGAAAG 3'
Rev: 5' GCTCTAGA AGCAGCAGACAAGGGGGTAG 3'
58
C2.2 642–881 Fw: 5' GCTCTAGA CTACCCCCTTGTCTGCTGCT 3'
Rev: 5' GCTCTAGA GTATGGCATCCCTCACCTTG 3'
58
C2.3 862–1226 Fw: 5' GCTCTAGA CAAGGTGAGGGATGCCATAC 3'
Rev: 5' GCTCTAGA GAAAGAAAATCAATAAAGTACAC 3'
56
C3 1167–1408 Fw: 5' GCTCTAGA GTTTCCACCTTACCCTACTG 3'
Rev: 5' GCTCTAGA AGTGACCCTCTGCCTCCCC 3'
58
C4 1368–1688 Fw: 5' GCTCTAGA TGCTGGAATAGGGACCTGG 3'
Rev: 5' GCTCTAGA GTGCTGTGTGAAGTCTGTG 3'
56
C5 1619–2326 Fw: 5' GCTCTAGA GGGACTGTCAGATAATCGGTG 3'
Rev: 5' GCTCTAGA TCCAGGTTTACAAGAAAAAGAGAA 3'
62
C6 2273–2687 Fw: 5' GCTCTAGA CCACAGGAATAATAGTTCAGG 3'
Rev: 5' GCTCTAGA GAATCAGCACAGTACAAAAATAAAT 3'
56
C6del 2273–2636 Fw: 5' GCTCTAGA CCACAGGAATAATAGTTCAGG 3'
Rev: 5' GCTCTAGA CAGCCAAACTGAGCTTCATG 3'
58
  1. XbaI recognition site sequence is underlined