Skip to main content

Table 1 qPCR primers

From: Expression of GBGT1 is epigenetically regulated by DNA methylation in ovarian cancer cells

Gene Accession number Gene Name Forward Primer 5’-3’ Reverse Primer 5’-3’ Amplicon size in bp
A4GALT NM_017436 α1,4-galactosyl transferase CGCTGGAGCTAGAGATGGATTTGC AGCCGACCTTCTTTGCCAACAC 78
GLA NM_000169 α galactosidase A precursor TCTAATGACCTCCGACACATCAGC ACACTTCAAAGTTGTCTCCCTGTC 130
HEXA NM_000520.4 β hexosaminidase α chain precursor TTTGTCACACTTCCGCTGTGAG ACTCCTGCTCACAGAAGCCTAC 80
GBA NM_001171812 glucosidase, β, acid ACAGCCACAGCATCATCACGAAC TGGGACTGTCGACAAAGTTACGC 117
UGCG NM_003358 UDP-glucose ceramide glucosyltransferase TGTGTTGGATCAAGCAGGAGGAC AACCTCCAACCTCGGTCAGCTATC 96
B4GALT6 NM_004775 UDP-Gal:βGlcNAcβ1,4- galactosyltransferase, polypeptide 6 AGGAGGTCCCTATGGCACTAAC TCTCTACAGACAGGCCCATTAGTC 89
GLB1 NM_001079811 galactosidase, β1, transcript variant 1 TGGCCAGCCATTTCGCTACATC TGAAAGTTCCAGGGCACATACGTC 135
HEXB NM_000521 β-hexosaminidase β chain precursor GCAAGTGCTGTTGGTGAGAGAC GTTGTGCAGCTATTCCACGTTCG 118
GBGT1 NM_021996.4 Globoside α-1,3-N-acetylgalactosaminyltransferase 1 GCACAAGCTTCAGTGTCCTGTG TGGCTTCTCCCTCTTGTAGTGC 122
B3GALNT1 NM_033169 β1,3-N-acetylgalactosaminyl transferase 1 TGCTCTATCACGTGGTGCTCTC ACGCGAGCCGAAGGTTCTTTAC 62
NAGA NM_000262.2 N-acetylgalactosaminidase, α AGCTTCCAGAGCCCAACACATAC ACATGTCCCAGCAAGAGCACTG 113
HSPCB NM_007355 Heat shock protein 90 kDa α TCTGGGTATCGGAAAGCAAGCC GTGCACTTCCTCAGGCATCTTG 80
YWHAZ NM_001135702 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypetide ACTTTTGGTACATTGTGGCTTCAA CCGCCAGGACAAACCAGTAT 94
SDHA NM_004168 Succinate dehydrogenase complex, subunit A TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATG 86