Skip to main content

Table 2 RT-qPCR reference gene primer sequences and characteristics for all candidate reference genes

From: Gene expression studies for the analysis of domoic acid production in the marine diatom Pseudo-nitzschia multiseries

Predicted gene product Primer sequence GC (%) Tm(°C)a Amplicon (bp) Ex-ExSpanningb Efficiency (%) R2
JmjC F: CCAGTTATGATTTCGGCAATAATGG 40.0 54.5 139 No 96.8 0.991
  R: GGTGTCAGTTCATCGTCTTCAG 50.0 55.4
Dynein F: CGAAGCCAGTAGTGGTATCAAGG 52.2 57.1 84 No 98.0 0.991
  R: CGAATCAGGTTGTTCTGGAGTCG 52.2 57.6
Histone H3 F: GAAGCCTACCTGGTGGGTCTC 61.9 59.3 151 No 101.4 0.999
  R: CGTCCGATCACCTTCCGTCTC 61.9 59.5
Cyclophilin F: GTAGGACAAAGCCAGCACAACAGG 54.2 60.2 83 No 99.0 0.997
  R: GAATGAATCGGTGCTCGTAGGAGG 54.2 59.2
Cyclophilin Ex-Ex F: CTGGGTTTCAAGAGCCAACGAC 54.5 58.5 105 Yes 98.3 0.997
  R: CATCAATGCCGACGGACTGAAT 50.0 57.7
EF-1á F: GGACTCTCCATCAAGGGTATTGC 52.2 57.3 150 No 98.4 1.000
  R: GTATCCAGGCTTGAGGACACC 57.1 57.4
PGK F: GATGCCGAGAAGAAGGGTGTG 57.1 58.0 69 No 98.7 0.996
  R: CGAAGGAAATGCTTGTGTTGCGAC 50.0 59.2
eIF-2 F: GTGATGCGTGCTTGATTGCTTG 50.0 57.6 78 No 99.6 0.997
  R: CCTTCATGTCGTGGCGAAGC 60.0 59.0
ATPasec F: GGTGGTGATATTGCTCCCTTG 52.4 55.7 164 No 98.4 0.996
  R: CGTTGATCTTCACTGATCTTTAGTCG 42.3 55.4
Ubiquitin F: CCTTCGTCGGAACATCACTACC 54.5 57.3 126 No 94.1 0.997
  R: CGTCAAGGGTGATAGTCTTGC 52.4 55.5
GAPDH F: GACAACTTCCACAAGGTCATCTCC 50.0 57.5 83 No 100.3 0.999
  R: CTGGTGTAGACAGCCAAGTCG 57.1 57.6
18s rRNA F: GTTGCCCGCCACTCTTTACGATTG 54.2 60.6 81 No 98.0 0.998
  R: GTATCAGTGCCAAGCCTCTGC 57.1 58.3
β-tubulin Ex-Exd F: CCAAATTCTGGCAGGTCATG 50.0 54.2 114 Yes 100.8 0.998
  R: CTTGTCCCTCGTTGAAGTACAC 50.0 55.4     
  1. aThe annealing temperature for all standard curve analyses was performed at 60°C to demonstrate the efficiency of the primer sets under our assay conditions; the calculated Tm values are provided for reference.
  2. b'Ex-Ex spanning’ refers to primers that span an exon-exon junction; these primer sets did not yield a product using gDNA as a template.
  3. cThe PSN0332 contig sequence had an extra “t” in the reverse primer region as compared to the Pseudo-nitzschia multiseries genome sequence, yet the primer set demonstrated high efficiency.
  4. dβ-tubulin was not used in the studies presented as it was not printed on the microarray. It is a validated exon-spanning primer set that demonstrated good efficiency, and may have value as a reference gene for future studies.