Skip to main content

Table 1 Pseudo attP sites in pig kidney PK15 cell line

From: Pseudo attP sites in favor of transgene integration and expression in cultured porcine cells identified by streptomyces phage phiC31 integrase

Site Sequencea,b Identity to attP (%)c Genomic location Integration frequencyd
attP CCCCAACTGGGGTAACCTTTG AGTTCTCTCAGTTGGGGG 100   
5113 AAGGA TTTGG ATT TCATC TGT GTAT GCTCAGTACTTTTT 18 Chr1, † , 114220089–114220127,Int.Ge 2/6=33%
5156 TGGATTTGGG TG CCAC GG TGA CTCAGATGGGAT GCCGGG 26 Chr7, − , 45581124–45581162,Int.G 2/6 = 33%
1015 GCC TGGTATCATCAA ACA TTT A TGGGATCTCTGCCATG T 23 Chr9, − , 42746366–42746404,Int.G 1/6 = 17%
2015 ATAC CCC CAATATA GC TC TGA A AT AC CAATGG GTG TTCC 31 Chr3, - , 54698718–54698756,Int.G 1/6 = 17%
  1. aThe TTG core in the wild-type attP site and similar core in pseudo attP site of pig genome are shown in bold.
  2. bNucleotides identical to the wild-type site at that position are underlined.
  3. cThe identity is calculated by Bioedit.
  4. dIntegration frequency = recombination clones/total selected clones × 100%.
  5. eInt.G, intergenic region.