Skip to main content

Table 3 Oligos

From: Recombination Phenotypes of Escherichia coli greA Mutants

aof2 TCCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTTAGGTGGCGGTACTTGGGT
ARB1a GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT
ARB2a GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC
ARB6a GGCCACGCGTCGACTAGTAC
bpa TCTGGTGGCCGGAAGGCGAAGCGGCATGCATTTACGTTGAGGTCTGACAGTTACCAATGC
BLZ3 GAACTTTAAAAGTGCTCATCATTG
BLZ4 GGGTTTTCCCAGTCACG
cat27 TCGGAGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATGAGACGTTGATCGGCACG
cat28 AGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTCAGGCGTAGCACCAGGC
cat29 GACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGGATCCATGAGACGTTGATCGGCACG
cat30 TGGCTAAATACGGAAGGATCTGAGGTTCTTATGGCTCTTGGATCCATTCAGGCGTAGCACCAGGC
cat34 TCAAAATCGTCAACCCGATTATGGGCGTGAAATTCTGGGAATGAGACGTTGATCGGCACG
cat35 GCGTACTGTGACTTCTTCTGCCGGGATCTTCACGCTCTCAATTCAGGCGTAGCACCAGGC
cat38 AGGTTGATATTGATTCAGAGGTATAAAACGAATGAGTACTATGAGACGTTGATCGGCACG
cat39 CCTACCCGGATATTATCGTGAGGATGCGTCATCGCCATTGATTCAGGCGTAGCACCAGGC
cat40 CACCGTTACACATATGCAGGATGAAGCAGCCAACTTCCCGATGAGACGTTGATCGGCACG
cat41 CGCAGTTCGAGGCTGAACTCTTCTTCCTGGGCTGCACGGTATTCAGGCGTAGCACCAGGC
D41A AGCTGCGTGGTATTCGGCGTTTTCTTTCAGGGCGCCATGCTCACGCGCTTCCGCGATAGCAGCAA
D41N AGCTGCGTGGTATTCGGCGTTTTCTTTCAGGTTGCCATGCTCACGCGCTTCCGCGATAGCAGCAA
dksAD AGTGCGTGTTAAGGAGAAGCAACATGCAAGAAATGGCTGGCTAATTACAGCCGTTCCATCACGT
dksNN CATATGCAGGATGAAGCAGCCAACTTCCCGAACCCGGTAAACCGTGCAGCCCAGGAAGAAGAGTTCAGCC
E44K CTGTTCACGAGCTGCGTGGTATTCGGCGTTTTTTTTCAGGTCGCCATGCTCACGCGCTTCCGCGA
greA5 CATCATCATGAATTCAGCTGGTCAATCCGATGA
greA6 ACTACTACTGGATCCTGTACAGGTCATCGGTAAAACG
greA9 TGAAATCATTGCTGCTATCGCGGAAGCGCGTGAGCATGGCCTCGACATCTTGGTTACCGT
greAD ACATCTTGAGTATTGGGTAATTCTTACAGGTATTCAGCTTGCATTTGTTATACCTCTTGAATATTCCTGA
greAX CTGTTCACGAGCTGCGTGGTATTCGGCGTTTTCTTTCAGGCGCGGAATAACATCATTTGG
greAY GCTGCTATCGCGGAAGCGCGTGAGCATGGCGACCTGAAAGCTCGACATCTTGGTTACCGT
greAZ AGAAACCCTGCTGTTCACGAGCTGCGTGGTATTCGGCGTTCGCGGAATAACATCATTTGG
PRO1 TGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTACAACCAATTAACCAATTCTG
PRO2 GTCACGACGTTGTAAAACGACGGCCAGTGAATCCGTAATCACGTTGTGTCTCAAAATCTC
Rtet1a CCACTTAATGTGATCATTGAACC
Rtet2a AACCATTTTCAGTGATCCATTGC
SP01 ATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGTGGCAGCATCCATGGAAAAGAGAAG
SP02 TTGCTCCCCAAATACAAAACCAATTTCAGCCAGTGCCTCGCATATGAATATCCTCCTTAG
SR2 GACTACGACTACATCTAGATTCGAACATCGATATGGGCAACTCTATC
SR3 ATCAGCCATCATGGATCCGTTTGCAATGGCGTACCTT
  1. a. Arbitrary PCR and sequencing to locate transposon insertions was done as described [47], but with primers designed for Tn10d(tet). The first round of PCR was done with primers Rtet1, ARB1, and ARB6; the second with Rtet2 and ARB2. Sequencing was done with Rtet2.