Skip to main content

Table 1 Primers and probes used for real time RT-PCR analysis.

From: Evaluation of potential reference genes for real time RT-PCR studies in Atlantic halibut (Hippoglossus Hippoglossus L.); during development, in tissues of healthy and NNV-injected fish, and in anterior kidney leucocytes

Gene Forward Revers Probe E%
ACTB1 CGGTCGTACCACAGGTATCGT GGATCTTCATCAGGTAGTCAGTCAGA TCTGGTGACGGT-MGB 90
EF1A1 CCATGGTTGTGGAGTCCTTCTC GATGACACCGACAGCCACTGT CTCCCCTCGGTCGTTTCGCTGTG 96
HPRT1 GTGGACTTCATTCGCCTCAAG TCTCCACCGATAACTTTGATTTCA ACTGGTCGTTACAGTAGC-MGB 98
RPL7 GAAGGCTCTCGGCAAATATGG GCCAACTGTGTAAATCTCATGGAT TCCTCGACGCAGATGA-MGB 94
Tubb2C GCTGGACAGGATAAACGTGTATTTACA GTGCCCGGCTCCAGATC CCTCAGGCGGTAAAT-MGB 93
UbcE GAACTGGAAACCAGCGACAAA CGCTCACCAGAGCAATGAGA ACCATCCAAGTGATCAATA-MGB 98
  1. The primers and probes are listed 5' → 3' direction with the corresponding PCR efficiency (E%). All probes are marked with 6-carboxyfluorescein (6FAM). Abbreviation: MGB - minor groove binder.