Skip to main content

Table 1 List of primers used for qRTPCR.

From: Inflammation in the avian spleen: timing is everything

Target Identity Sequence Accession # Size
Bmal1 Fwd ggaattccaggaggaacaaga AF205219 60
  Rv ttcttcagcaatcatccttcc   
Bmal2* Fwd gaagtccggtataaaccttcgtt AF246958 65
  Rv gcagccctaaggattaactgtct   
Clock Fwd acacgcatgatagaggcaaa AF246959 62
  Rv tgttcttgaattttccgcaact   
Cry1* Fwd cggacctgtacaaaaaggtaaaa NM_204245 61
  Rv agctggccatagagggagag   
Cry2 Fwd tctggcgggagtttttctac NM_204244 60
  Rv cctccatgcgatcaaacttc   
Per2 Fwd cgaggtcagggggttctact NM_204262 61
  Rv gatatcagcttgctgctcagg   
Per3* Fwd tttaggctctcactcctgtgaa AY046567 60
  Rv ttgctgtttttcccactgtct   
IL-1β Fwd ggtggccatgaccaaact NM_204524 61
  Rv caggtcgctgtcagcaaag   
IL-2 Fwd gagtgcacccagcaaactct NM_204153 66
  Rv ttcagtttctttcttcagagtaacca   
IL-6* Fwd caggacgagatgtgcaagaa NM_204628 64
  Rv tgttccggacgagcatct   
IL-12b Fwd ccaccgaagtgaaggagttc NM_213571 63
  Rv cgtgggtcttagcagacagg   
IL-18* Fwd agagcatgggaaaatggttg NM_204608 60
  Rv ccaggaatgtctttgggaac   
TNF ά Fwd acaaaatttgcaggctgtttc AY765397 60
  Rv ctgaaataaacaggcacaaaagag   
GAPDH* Fwd ggagtccactggtgtcttcac NM_204305 64
  Rv cttagcaccacccttcagatg   
  1. Fwd = forward primer; Rv = reverse primer; Size = expected amplicon size. Primer pairs that also spanned an intron are indicated by an *.