Skip to main content

Table 8 Nucleotide sequences of the primers used in the qPCR reactions and the length of the amplicons generated

From: The Renilla luciferase gene as a reference gene for normalization of gene expression in transiently transfected cells

Transcript (amplicon length) Primer Sequence (5' to 3')
Fluc (137 nts) prMJ296 AGGTGGCTCCCGCTGAAT
  prMJ297 FAM-CGGGAAGACCTGCGACACCTGCGT-BHQ1
  prMJ298 CATCGTCTTTCCGTGCTCCA
Rluc (140 nts) prMJ274 GCAGAAGTTGGTCGTGAGG
  prMJ272 HEX-CTCACTATAGGCTAGCCACCATGACTTCGAAAG-BHQ1
  prMJ276 TCATCCGTTTCCTTTGTTCTG
B2M (125 nts) prMJ348 TCTCTGCTCCCCACCTCTAA
  prMJ349 FAM-CCAGCCCTCCTAGAGCTACC-BHQ1
  prMJ350 ATCTGAGCAGGTTGCTCCAC
ActB (142 nts) prMJ351 CTCGGCCACATTGTGAACTT
  prMJ352 FAM-ATGCTCGCTCCAACCGAC-BHQ1
  prMJ353 AACGGTGAAGGTGACAGCA
  1. Abbreviations: BHQ1- Black Hole Quencher 1, FAM- Fluorescein, HEX- hexachlorofluorescein phosphoramidite