Skip to main content

Table 1 Primers used in BAC library screen, promoter analysis and real-time RT-PCRs

From: Promoter analysis of the rabbit POU5F1 gene and its expression in preimplantation stage embryos

Primer name Primer (5'-3') sequence Position Primer size (bp) Tm (°C)
oct4-435-F AGCTTAGCTTCAAGAACATG +3665 20 60.0
oct4-435-R AGGAGTACAGTGCAGTGAAG +4704 20 60.0
oct4-186-F AGCAGAAACCCTCGTGCAGG +3759 20 60.0
oct4-186-R TCTGGCGCCGGTTACAGAAC +4181 20 60.0
*oct4-pseudo-F GCTAAACAGAAAGAAGTTTGCC * +420 22 57.0
*oct4-pseudo-R GAACAGTCACTGCTTGATCGTTT * +870 23 58.1
oct4-cDNA-F GCTCTACAGAAAGAACTCGAGCAG +3640 24 57.9
oct4-cDNA-R CGAGTACAGGGTAGCAAAGTGAG +4869 23 60.0
CR1-ATGmut TCTATGGGGGAAGGAGGGCG +5 20 60.0
CR1 AGGCTGGTGGCATAAAACAC -558 20 60.0
CR1+(CR2+CR3) GCCAGACTAGAGCCCAACAG -1585 20 60.0
CR1+(CR2+CR3)+CR4 GGGAAATTGTGGAGGAGGAC -2030 20 60.7
CR4 TCTGTCTGCTTGGTGGTGTC -1670 20 59.9
Rabbit-oct4-RT-F CGAGTGAGAGGCAACTTGG +4418 19 55.5
Rabbit-oct4-RT-R CGGTTACAGAACCACACACG +4730 20 56.1
*Rabbit-oct4p-RT-F CTAAACAGAAAGAAGTTTGCC * +421 21 53.7
*Rabbit-oct4p-RT-R CGCAGCTTACACATGTACT * +594 19 52.3
Mouse-oct4-RT-F ATGCCGTGAAGTTGGAGAAG +343 20 56.5
Mouse-oct4-RT-R GGTCTGGCTGAACACCTTTC +3309 20 55.9
  1. The initial ATG is signed as +1, the positions show the genomic locations of the primer. F: forward, R: reverse * pseudogene-specific primers, the positions show the pseudogene location of the primers