Skip to main content

Table 3 qPCR primer sequences, and amplification parameters.

From: Selection of reference genes for expression studies with fish myogenic cell cultures

Gene Primer sequence (5'-3') Amplicon
size (bp)
Tm (°C) E (%)
plasmid
R2
plasmid
E (%)
cDNA
R2
cDNA
EF1α f: GAATCGGCTATGCCTGGTGAC
r: GGATGATGACCTGAGCGGTG
141 86.0 96.0 0.998 99.5 0.999
RNApolII f: CCAATACATGACCAAATATGAAAGG
r: ATGATGATGGGGATCTTCCTGC
157 84.8 95.3 0.996 98.5 0.999
18SrRNA f: TCGGCGTCCAACTTCTTA
r: GCAATCCCCAATCCCTATC
189 86.5 95.6 0.995 94.5 0.999
Ppia f: CATCCCAGGTTTCATGTGC
r: CCGTTCAGCCAGTCAGTGTT
203 85.9 96.4 0.998 96.5 0.999
Pgk1 f: CTCGGTGATGGGGCTTAGG
r: TCATTGGTGGAGGCGACA
160 87.0 98.1 0.999 99.5 0.999
Actb f: TGACCCAGATCATGTTTGAGACC
r: CTCGTAGATGGGTACTGTGTGGG
146 83.8 93.2 0.997 100 0.999
Hprt1 f: CCGCCTCAAGAGCTACTGTAAT
r: GTCTGGAACCTCAAACCCTATG
255 81.8 92.1 0.996 90.0 0.997
Sdha f: CATGTTACCAAGGGCTGCAT
r: GTGTCAGATGATATCTCAACCCAG
207 85.8 99.0 0.997 95.5 0.998
Des f: GTCCATCTGGATCTGCACCT
r: GGCTGCTTTCAGAGCTGATG
169 82.8 99.5 0.998 99.0 0.996
  1. PCR efficiencies, amplicon melting temperature (Tm) and correlation coefficients of standard curves (from plasmid and cDNA) for candidate reference genes and desmin.