Skip to main content

Table 2 Primer sequences and amplicon characteristics for each of the 11 reference genes

From: Selection of reliable reference genes for gene expression studies in peach using real-time PCR

Name Forward Primer Sequence [5'-3'] Reverse Primer Sequence [5'-3'] Amplicon Size (bp) Product TM (°C) # RT-qPCR Efficiency* R2*
18S rRNA TAGTTGGTGGAGCGATTTGTCTG CTAAGCGGCATAGTCCCTCTAAG 114 88.2 1.796 0.9995
ACT GTTATTCTTCATCGGCGTCTTCG CTTCACCATTCCAGTTCCATTGTC 112 86.3 1.828 0.9993
CYP2 ACTCCAAAGCGTGTTAGAAAAGG GTCTCTTCCACCATAACGATAGG 120 90.4 1.767 0.9986
TEF2 GGTGTGACGATGAAGAGTGATG TGAAGGAGAGGGAAGGTGAAAG 129 88.3 1.818 0.9994
GAPDH ATTTGGAATCGTTGAGGGTCTTATG AATGATGTTGAAGGAAGCAGCAC 121 88.7 1.794 0.9994
PLA2 TCGCCGTCGTTATCTTCTCC TACCGAATCCCAACAGAATTACAG 115 90.8 1.765 0.9995
RP II TGAAGCATACACCTATGATGATGAAG CTTTGACAGCACCAGTAGATTCC 128 85.3 1.800 0.9996
RPL13 GCAGCGACTGAAGACATACAAG GGTGGCATTAGCAAGTTCCTC 103 87.7 1.671 0.9952
TUA TTCTCTCTACTCATTCCCTCCTTG GATTGGTGTATGTTGGTCTCTCG 117 83.9 1.812 0.9993
TUB CCGAGAATTGTGACTGCCTTCAAG AGCATCATCCTGTCTGGGTATTCC 124 88.2 1.826 0.9994
UBQ10 AAGGCTAAGATCCAAGACAAAGAG CCACGAAGACGAAGCACTAAG 146 89.5 1.795 0.9994
  1. # The melting temperature of specific PCR product was calculated by Rotor-Gene V6.1 software (Corbett Research). * The RT-qPCR efficiency and correlation coefficients (R2) were determined with LinRegPCR software [67].