Skip to main content

Advertisement

Table 2 Primer sequences of housekeeping genes

From: Identification and validation of housekeeping genes in brains of the desert locust Schistocerca gregaria under different developmental conditions

HKG Forward primer Reverse primer Amplicon
GAPDH GTCTGATGACAACAGTGCAT GTCCATCACGCCACAACTTTC 81
TubA1 TGACAATGAGGCCATCTATG CGCAAAGATGCTGTGATTGA 118
Ubi GACTTTGAGGTGTGGCGTAG GGATCACAAACACAGAACGA 76
ACT AATTACCATTGGTAACGAGCGATT TGCTTCCATACCCAGGAATGA 73
EF1a GATGCTCCAGGCCACAGAGA TGCACAGTCGGCCTGTGAT 65
RP49 CGCTACAAGAAGCTTAAGAGGTCAT CCTACGGCGCACTCTGTTG 66
CG13220 TGTTCAGTTTTGGCTCTGTTCTGA ACTGTTCTCCGGCAGAATGC 62