Skip to main content

Advertisement

Table 1 PCR Primer and hydrolysis probe sequences for the five human total RNA targets.

From: Selective control of primer usage in multiplex one-step reverse transcription PCR

Target (Length) NCBI Accession Number Transcript length (nt) primer and Probe Information
    primer/probe type Sequence (5'-3') 5' position Limit of detection
PBGD (265 bp) NM_000190.3 1526 Forward primer GAGTGATTCGCGTGGGTACC 213 n.d.
    Reverse primer GGCTCCGATGGTGAAGCC 476  
    Hydrolysis probe - -  
ABCA5 (82 bp) NM_172232.2 8177 Forward primer GGCTGCTATTCTGACCACTCACTATA 4598 < 7.6E+01 copies
    Reverse primer TTAACTGCCCAGACACCATGAT 4659  
    Hydrolysis probe 6 FAM - CAGAGGCTGTCTGTGATCGAGTAGC - BHQ1 4633  
ABCA6 (114 bp) NM_080284.2 5296 Forward primer CCATGAGAAATGTCCAGTTTCCT 324 <1.6E+01 copies
    Reverse primer TGCTGGGTTAAATTAGATATTGGTGTA 412  
    Hydrolysis probe Alexa Fluor®647-TCCTCAGAATCTGGGAAGGGTAGATAAA-BHQ2 355  
ABCA7 (147 bp) NM_019112.3 6832 Forward primer TTTCTCTGGGACATGTGTAACTACTTG 4981 <8.9E+01 copies
    Reverse primer TGTGATCGACCAGCCATACAG 5104  
    Hydrolysis probe HEX C6-NH- CCTTCCAGCAGAGGGCATATGTG - BHQ1 5042  
ABCA10 (61 bp) NM_033450.2 5118 Forward primer GCGGGTTAAGCTTGTGACAGA 1601 n.d
    Reverse primer CCCACCCGCAGAACTTGA 1645  
    Hydrolysis probe - -  
  1. To complement the PCR primer and hydrolysis probe sequences, this table also includes the NCBI Accession Number, the amplicon length, the transcript length, the position along the transcript of the primers/probes, and the lowest limit of detection for each of the RNA standards (ABCA5, ABCA6, and ABCA7).