Skip to main content

Table 1 PCR primer pairs.

From: Removal of Hsf4 leads to cataract development in mice through down-regulation of γS-crystallin and Bfsp expression

Gene name Primers Annealing temperature
hHSF4F CCCCCTCAAGAAAGTGTGGAA 60°C
hHSF4R GAACCAAGGGCTGCATCAAG 60°C
mHSF4F GGCACCAGCTTCCTCGTAAG 60°C
mHSF4R CCTTCCGAAAACCATACATGTTG 60°C
hCrygsF CCCAACTTTGCTGGGTACATG 60°C
hCrygsR GGCCTCCACTAGGCAGATGA 60°C
mCrygsF AGCGTTGGATGGGCCTTAAT 60°C
mCrygsR GTTTCGTACATCTGACCGTTGAAG 60°C
hBFSP1F TTCAGTGGGAGAGAGATGTTGAAA 60°C
hBFSP1R CTCCTGGGTCTGGGACATGT 60°C
mBfsp1F AGACGCCCATCTCTCTGATCA 60°C
mBfsp1R AGGGCCTTCTGTCTCGGTTT 60°C
hBFSP2F TTCAGTGGGAGAGAGATGTTGAAA 60°C
hBFSP2R CTCCTGGGTCTGGGACATGT 60°C
mBfsp2F GCACCGGTCTGGATGATGTC 60°C
mBfsp2R ACGTGGACCACCTCTGTCTG T 60°C
mLp82F ATTGGCTTCGCCATCTACGA 60°C
mLp82R CCCGCATGTTGATGTAGGTTT 60°C
mCalpain2F ATGCGGAAAGCACTGGAAGA 60°C
mCalpain2R CCAAACACCGCACAAAATTG 60°C
\