Skip to main content

Advertisement

Table 1 Oligonucleotide sequences used for Taqman PCR and siRNA sequences

From: The effect of BACE1-AS on β-amyloid generation by regulating BACE1 mRNA expression

Primer name Application Sequence or assay ID
1. Human BACE1-AS–F Real-time PCR GAAGGGTCTAAGTGCAGACATCTT
2. Human BACE1-AS–R Real-time PCR AGGGAGGCGGTGAGAGT
3. Human BACE1-AS–P Real-time PCR ACATTCTTCAGCAACAGCC
4. Mouse BACE1-AS–F Real-time PCR GTAGGCAGGGAAGCTAGTACTGA
5. Mouse BACE1-AS–R Real-time PCR AGAGGCTTGCAGTCCAGTTC
6. Mouse BACE1-AS–P Real-time PCR CCTGGAAGGAGAAACAG
7. Human BACE1–F Real-time PCR Taqman(Assay ID: Hs00201573_m1)
8. Human BACE1–R Real-time PCR Taqman(Assay ID: Hs00201573_m1)
9. Human BACE1–P Real-time PCR Taqman(Assay ID: Hs00201573_m1)
10. Mouse BACE1–F Real-time PCR Taqman(Assay ID: Mm00478664_m1)
11. Mouse BACE1–R Real-time PCR Taqman(Assay ID: Mm00478664_m1)
12. Mouse BACE1–P Real-time PCR Taqman(Assay ID: Mm00478664_m1)
13. Human BACE1-AS siRNA_a siRNA CCCTCTGACACTGTACCATCTCTTT
14. Human BACE1-AS siRNA_b siRNA AGAAGGGTCTAAGTGCAGACATCTG
15. Human BACE1-AS siRNA_c siRNA CCAGAAGAGAAAGGGCACT