Skip to main content

Advertisement

Table 1 Primers used in this study

From: Comparison of miRNA-101a-3p and miRNA-144a-3p regulation with the key genes of alpaca melanocyte pigmentation

Gene Primers (5′–3′)
MITF
 F CGAAAGTTGCAACGRGAACAGCA
 R GAGCCT GCATTTCAAGTTCCTGTA
TYR
 F TCTGGACCTCAGTTCCCCTTC
 R AACTTACAGTTTCCGCAGTTGA
TYRP1
 F TGGCACAATGACGTATTCTTAGT
 R GGGTAGGAGGTAGGAGATGATG
TYRP2
 F AGCAGACGGAACACTGGACT
 R GCATCTGTGGAAGGGTTGTT
18S
 F GAAGGGCACCACCAGGAGT
 R CAGACAAATCACTCCA
miR-101a-3p TACAGTACTGTGATAACTGAA
miR-144a-3p TACAGTATAGATGATGTACT
U6 ATGGACTATCATATGCTTACCGTA