Skip to main content

Advertisement

Table 1 Primers for qRT-PCR

From: MicroRNA-325-3p protects the heart after myocardial infarction by inhibiting RIPK3 and programmed necrosis in mice

Gene Sequence (5′–3′)
miR-92b-3p  
 Forward primer CCGCCCTGCTCACGTTAT
 Reverse primer AGTCTCAGGGTCCGAGGTATTC
miR-5105  
 Forward primer GGCGCCGCTCGT
 Reverse primer CAGTGCGTGTCGTGGAGT
miR-3102-5p  
 Forward primer GTGGTGCAGGCAGGA
 Reverse primer CAGTGCGTGTCGTGGAGT
miR-3059-5p  
 Forward primer TTCCTCTCTGCCCATAG
 Reverse primer CAGTGCGTGTCGTGGAGT
miR-17-3p  
 Forward primer CAGTAAAGGTAAGGAGAGCTCAATCTG
 Reverse primer CATACAACCACTAAGCTAAAGAATAATCTGA
miR-148a-5p  
 Forward primer TCAGTGCACTACAGAACTTTGT
 Reverse primer GCTGTCAACGATACGCTACGT
miR-409-3p  
 Forward primer AGGAATGTTGCTCGGTGA
 Reverse primer CAGTGCGTGTCGTGGAGT
miR-876-3p  
 Forward primer TGGATTTCTTTGTGAATCACCA
 Reverse primer GTGATTCACAAAGAAATCCATT
miR-133a-3p  
 Forward primer TTTGGTCCCCTTCAACCAGCTG
 Reverse primer TAAACCAAGGTAAAATGGTCGA
miR-448-3p  
 Forward primer GCTGAGGGAGATATCGGCGCC
 Reverse primer GGAACACGCATGGCAGATCC
miR-325-3p  
 Forward primer GCCAGCACCTTCACAAAGTAGC
 Reverse primer CCATGCTAGACAACAGCTCTG
RIPK3  
 Forward primer CCTCTCAGTCCACACTCCGA
 Reverse primer TGACGCACCAGTAGGCCAT
GAPDH  
 Forward primer AGCCACATCGCTCAGACAC
 Reverse primer GCCCAATACGACCAAATCC
U6  
 Forward primer ATTGGAACGATACAGAGAAGATT
 Reverse primer GGAACGCTTCACGAATTTG