Skip to main content

Advertisement

Table 5 The primer sequences for real time quantitative PCR

From: MEF2A alters the proliferation, inflammation-related gene expression profiles and its silencing induces cellular senescence in human coronary endothelial cells

Serial no. Genes Forward primer (5′ to 3′) Reverse primer (5′ to 3′) Tm (°C)
1 MEF2A AGCAGCCCTCAGCTCTCTTG GGTGAAATCGGTTCGGACTTG 60
2 PIK3CG TCCTCTTTGTGATGGGAACTT TGTGTGATGACGAAGGGCT 60
3 SERPIND1 TGATTCTCAACTGCATCTACTTC CCTCTCTCTCATTCAGCCG 60
4 IL1B ACAGTGGCAATGAGGATG TGTAGTGGTGGTCGGAGA 60
5 ENPP1 ACTGCGAAAGTATGCTGA TTCTTGGTTACGGATGAC 60
6 ZAK GCGGTGGAGGAAGATTTG TGACTGAGGACCCTGAGTATTT 60
7 FOS TACTACCACTCACCCGAAGA GAATGAAGTTGGCACTGGA 58
8 MMP1 AAACCCCAAAAGCGTGTG GGGTAGAAGGGATTTGTGC 60
9 DQB1 CTGGTGATGATGGAAATGAC TTGCTCTGGGCAGATTCA 60
10 GUCY1A3 GGAGCCGAGTCTATCTTCA TGTGCTGTGCCAATGTTC 60
11 MYL9 AACGCCTTTGCCTGCTTC CATCTCGTCCACTTCCTCATC 60
12 GJA5 GGCAAGGAAATAGTAGGG TTGGCAGTCTCATTAGGG 60
13 CSF2 CCTGTGCAACCCAGATTA TGGCTACCAGCAGTCAAA 60
14 TRIM GGGTGTCCACATAATTGTTGT GCCCTAACTGGTATGTTACG 60
15 MRPL45 GAAATGTTGTCAGGGTGTTG CCTTAAAGTCACATCGCTCA 60
16 SGK196 ACCTGGAAGAAACACTAAACC GGTCGTTGGAGTCGCACA 60
17 BCL2A1 CATCATTAACTGGGGAAGAA ATTATGAACTCCGCAACAAA 60
18 NR5A2 CGTGGAGGAAGGAATAAG TCAGGTCAGAGGGCATAG 60
19 ANK3 CCTATTTATGTTGATTGTTATGG CTTGGCTGGTGTCTCTAATCT 60
20 PYHIN1 AAGGAGAATGCCACAATATC TGTCTCTGGATGAAACTATGC 60