Skip to main content

Advertisement

Table 4 Details of primers used for amplification of RNAi pathway genes

From: RNA sequencing, selection of reference genes and demonstration of feeding RNAi in Thrips tabaci (Lind.) (Thysanoptera: Thripidae)

Gene name Sequence information Primer Name Primer Sequence (5′→3′)
SID-1 CDS_23342_transcript_23605 qTt_SID1_F TGTTGCTTGGTGCGATACT
qTt_SID1_R GGTCAGAGCTGTGTTGAGATAA
Dicer-1 CDS_24712_transcript_26352 qTt_Dcr1_F TCTGCTTCTCGCTACGTTATG
qTt_Dcr1_R GTTTGCCGTTCTGCATGATAG
Dicer-2 CDS_25848_transcript_29057 qTt_Dcr2_F GTTTGACTCAGGGAACGAAGA
qTt_Dcr2_R GAAGTGAGTTGACGACAGAGAG
drosha CDS_15925_transcript_14592 qTt_drosha_F TCTGCTTCTCGCTACGTTATG
qTt_drosha_R GTTTGCCGTTCTGCATGATAG
Ago-1 CDS_15926_transcript_14593 qTt_Ago1_F CTCTCCCGAATTCACGACTAAC
qTt_Ago1_R ACTGTCTGCCTTGATCCAATAC
Ago-2 CDS_6124_transcript_5961 qTt_Ago2_F TGGGAGAGGTTGATCCTTGTA
qTt_Ago2_R ACAGGTTTCTGTCGGAATATGG
Alg CDS_16858_transcript_15514 qTt_Alg_F CATCATTCCATTCCCGCTGATA
qTt_Alg_R CCAGAAGCATCCACTCTTGTT
Piwi CDS_26052_transcript_29621 qTt_Piwi_F CATCATTCCATTCCCGCTGATA
qTt_Piwi_R CCAGAAGCATCCACTCTTGTT
Aub CDS_18257_transcript_16934 qTt_Aub_F GTTCCCGACATGAACAAGAAAG
qTt_Aub_R AGCTCTGGCGGAAAGTATAAG
SpindleE CDS_828_transcript_1424 qTt_SpindleE_F TCGCAAGGCACTCTCTACTA
qTt_SpindleE_R CAGAGGACAGCGTTGATTGT
Tdr CDS_9987_transcript_9161 qTt_Tdr_F GTCATCACACCAGATCCTAACC
qTt_Tdr_R GGATACTGCGAGTTACCTCTTC
Mut-7 CDS_3222_transcript_3490 qTt_Mut-7_F TTATCTGTGCCGGTGGAATAC
qTt_Mut-7_R CCAAGCTACGATACCCTCTTG