Skip to main content

Advertisement

Table 3 Primers used for qPCR

From: HexA is required for growth, aflatoxin biosynthesis and virulence in Aspergillus flavus

Primers Sequence (5′–3′) Description
hexA/QF CTCTTCACCCGCCAACT hexA qPCR
hexA/QR CGCCCTGAGGAACAACT  
aflK/QF GAGCGACAGGAGTAACCGTAAG aflK qPCR
aflK/QR CCGATTCCAGACACCATTAGCA  
aflD/QF TGTATGCTCCCGTCCTACTGTTTC aflD qPCR
aflD/QR TGTAGTCTCCTTAGTCGCTTCATC  
aflS/QF CGAGTCGCTCAGGCGCTCAA aflS qPCR
aflS/QR GCTCAGACTGACCGCCGCTC  
aflR/QF AAAGCACCCTGTCTTCCCTAAC aflR qPCR
aflR/QR GAAGAGGTGGGTCAGTGTTTGTAG  
actin/QF ACGGTGTCGTCACAAACTG actin qPCR
actin/QR CGGTTGGACTTAGGGTTGATAG