Skip to main content

Advertisement

Table 3 The most abundant known miRNAs obtained from HIST and NC libraries

From: Genome-wide identification of brain miRNAs in response to high-intensity intermittent swimming training in Rattus norvegicus by deep sequencing

miRNA name Sequence Length Read count miRNA family miRNA orthologs
HIST NC
let-7c TGAGGTAGTAGGTTGTATGGTT 22 2,314,478 1,205,674 let-7 hsa odi pma csa cin
miR-9a-5p TCTTTGGTTATCTAGCTGTATGA 23 1,889,962 1,416,714 mir-9 dme
let-7f TGAGGTAGTAGATTGTATAGTT 22 1,754,130 1,414,639 let-7 hsa
miR-378 ACTGGACTTGGAGTCAGAAGGC 22 1,544,707 1,452,656 mir-378 hsa ppy cfa
miR-143 TGAGATGAAGCACTGTAGCT 20 1,526,043 1,139,450 mir-143 rno mmu xtr pma
miR-182 TTTGGCAATGGTAGAACTCACACCG 25 1,638,730 326,627 mir-182 sko lgi cte mmu eca dre hsa spu
miR-9 TCTTTGGTTATCTAGCTGTATG 22 1,103,879 751,193 mir-9 egr sko bma xtr
let-7 TGAGGTAGTAGGTTGTATAGTT 22 804,332 490,827 let-7 cel aga sja spu
miR-30a TGTAAACATCCTCGACTGGAAGC 23 607,712 488,589 mir-30 hsa dre oan
miR-30d TGTAAACATCCCCGACTGGAAGC 23 594,387 413,656 mir-30 hsa pma oan bta
let-7b TGAGGTAGTAGGTTGTGTGGTT 22 638,961 307,685 let-7 hsa odi pma xtr cin
miR-127 TCGGATCCGTCTGAGCTTGGC 21 491,449 399,720 mir-127 mmu oar
miR-183 TATGGCACTGGTAGAATTCACT 22 623,293 125,748 mir-183 lgi mmu gga sko csa
let-7-5p TGAGGTAGTAGGTTGTATAGT 21 339,133 220,610 let-7 tca dme
miR-103a AGCAGCATTGTACAGGGCTATGA 23 280,569 274,894 mir-103 hsa pma
miR-24 TGGCTCAGTTCAGCAGGAACAGT 23 308,093 212,293 mir-24 hsa cfa
miR-26a TTCAAGTAATCCAGGATAGG 20 285,016 218,341 mir-26 hsa gga
miR-379 TGGTAGACTATGGAACGTAGG 21 272,494 226,457 mir-379 hsa
miR-99b CACCCGTAGAACCGACCTTGC 21 279,118 167,000 mir-99 mmu
let-7g TGAGGTAGTAGTTTGTACAGTT 22 227,155 185,745 let-7 mmu gga xtr dre