Skip to main content

Advertisement

Table 1 Description of seven candidate reference genes, primer sequences, and amplicon characteristics

From: Evaluation of suitable reference genes for qRT-PCR normalization in strawberry (Fragaria × ananassa) under different experimental conditions

Gene name Accession number Primer sequence (5′-3′) forward/reverse Amplicon size (bp) Annealing Tm (°C) Melting Tm (°C) E (%) R2 References
ACTIN1 LC017712.1 TTCACGAGACCACCTATAACTC GCTCATCCTATCAGCGATT 122 55 81 100.3 0.994
ACTIN2 AB116565.1 GCTAATCGTGAGAAGATGAC AGCACAATACCAGTAGTACG 119 55 81.5 97.8 0.998 [21]
18S X15590.1 TGTGAAACTGCGAATGGCTCATTAA GAAGTCGGGATTTGTTGCACGTATT 110 60 78.5 86 0.998 [15]
HISTH4 AB197150.1 TCAAGCGTATCTCCGGTCTC AGTGTCCTTCCCTGCCTCTT 163 60 85.5 92.9 0.999 [22]
GAPDH AB363963.1 GAGTCTACTGGAGTGTTCA CTTGTATTCGTGCTCATTCA 135 55 83.5 104.8 0.998 [23]
DBP XM_004291635.2 TTGGCAGCGGGACTTTACC CGGTTGTGTGACGCTGTCAT 72 60 80 108.6 0.995 [24]
PIRUV AF141016.2 AGGTGCGTTGCGAAGAGGA CTAAATCTGTGAATGCGAATGAGG 219 60 84.5 103.5 0.990 [15]