Skip to main content

Advertisement

Table 2 Guide RNA sequences

From: A protocol for custom CRISPR Cas9 donor vector construction to truncate genes in mammalian cells using pcDNA3 backbone

Gene I.D. for construct Sequence
FOXO3 HSL0001339461 CTTACTGAAGGTGACAGGCTGG
FOXO3 HSR0001339464 CACGGCTGACTGATATGGCAGG