Skip to main content

Advertisement

Table 1 Probe sequences used for Northern blotting

From: Nutrient depletion and TOR inhibition induce 18S and 25S ribosomal RNAs resistant to a 5′-phosphate-dependent exonuclease in Candida albicans and other yeasts

Name and sequence Chromosomal coordinatesa
18S 5′ probe
 GCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCT 1891221–1891411
18S 3′ probe
 TCCGGATTGGTTTAGGAAAGGGGGCAACCTCATTCTGGAACCGAGAAGCTGGTCAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTA 1892897–1893017
25S 5′ probe
 ATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGAC 1893459–1893685
25S 3′ probe
  AACATGCGCGGGGATAAATCCTTTGCATACGACTTAGATGTACAACGGAGTATTGTAAGCAGTAGAGTAGCCTTGTTGTTACGATCTGCTGAGATTAAGCTCTTGTTGTCTGATTTG 1896713–1896827
5S probe
 GGTTGCGGCCATATCTAGCAGAAAGCACCGTTCCCCGTTCGATCAACCGTAGTTAAGCTGCTAAGAGCAATACCGAGTAGTGTAGTGGGAGACCATACGCGAAACTATTGTGCTGCAATCT 1889054–1888934
ITS-2 probe
 TCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTG 1893319–1893469
  1. a http://www.candidagenome.org/